TABLE 1.
Primers | Direction 5′-3′ | Nucleotide sequence from 5′ to 3′ | Purpose |
---|---|---|---|
K1 | Forward | TTGCATATGGGTTTCCAACCCACTa | Gene fragment flanking for making sarsS |
K2 | Reverse | GTAGAATTCGTTGTTACATGTTCA | Gene fragment flanking for making sarsS |
B1 | Forward | TGAGTGAACCACAGCCAGAA | Integration of the pentF-sarsS plasmid DNA into the Enterococcus in chromosomal DNA |
Seq F | Forward | GGACACCACAACCATCGAAG | Sequencing of the PCR product of pentF-S1 |
Cov1 | Forward | AAGGATCCATACATATGGGTTTCC | Cloning a gene fragment sarsS for protein production |
Cov2 | Reverse | TGTCGACGGAGCTCGAATT | Cloning a gene fragment sarsS for protein production |
A1 | Forward | GCTCTAGAGCCGATGAGAGCAGCTGGTATTG | Determining the presence of inserts and a fragment of the sarsS gene in Enterococcus |
D1 | Reverse | CAACAGGATCCAAAGCATCGTTGG | Determining the presence of inserts and a fragment of the sarsS gene in Enterococcus |
Dal 1 | Forward | TTGAGGCAGACCAGATTGACG | D-alanine-D-alanine ligase |
Dal 2 | Reverse | TATGACAGCGACTCCGATTCC | D-alanine-D-alanine ligase |
The underlined area in the nucleotide sequences correspond to restriction sites used for cloning.