KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-CD3ε, PerCP-eFluor710, clone 17A2 | eBioscience (ThermoFisher) | Cat#46-0032-82, RRID:AB_1834428 |
| anti-CD4, APC-Fire 750, clone GK1.5 | Biolegend | Cat# 100459, RRID:AB_2572110 |
| anti-CD8, APC, clone 53-6.7 | eBioscience (ThermoFisher) | Cat#17-0081-83, RRID:AB_469336 |
| anti-CD11b, BV421, clone M1/70 | BD Biosciences | Cat#562605, RRID:AB_11152949 |
| anti-CD11c, APC-eFluor780, clone N418 | eBioscience (ThermoFisher) | Cat#47-0114-80, RRID:AB_1548663 |
| anti-CD16/32, purified, clone 93 | Biolegend | Cat# 101320, RRID:AB_1574975 |
| anti-CD25, APC-eFluor780, clone PC61.5 | eBioscience (ThermoFisher) | Cat#47-0251-82, RRID:AB_1272179 |
| anti-CD45, PE-Cy7, clone 30-F11 | eBioscience (ThermoFisher) | Cat#25-0451-82, RRID:AB_2734986 |
| anti-CD69, FITC, clone H1.2F3 | eBioscience (ThermoFisher) | Cat#11-0691-85, RRID:AB_465120 |
| anti-CD206, APC, clone 19.2 | eBioscience (ThermoFisher) | Cat#17-2069-42 RRID:AB_2573182 |
| anti-Dectin-1, clone (rabbit polyclonal) | Abcam | Cat#ab140039 RRID:AB_2877055 |
| anti-F4/80, FITC, clone BM8 | eBioscience (ThermoFisher) | Cat# 14-4801-82, RRID:AB_467558 |
| anti-FoxP3, PE-Cy5, clone FJK-16s | eBioscience (ThermoFisher) | Cat# 15-5773-82, RRID:AB_468806 |
| anti-MHCII, eFluor450, clone M5/114.15.12 | eBioscience (ThermoFisher) | Cat#48-5321-82, RRID:AB_1272204 |
| anti-PD1, PE-Dazzle 594, clone 10F.9G2 | Biolegend | Cat# 124324, RRID:AB_2565639 |
| anti-PD-L1, BV711, clone MIH5 | BD Biosciences | Cat# 563369, RRID: AB_2738163 |
| Anti-BrdU, clone BU20A | eBioscience (ThemoFisher) | Cat# 14-5071-82, RRID:AB_10596495 |
| Anti-Caspase 3 active (cleaved) form, clone (rabbit polyclonal) | Millipore Sigma | Cat# AB3623, RRID:AB_91556 |
| Anti-Granzyme B | Abcam | Cat#ab255598 RRID: AB_2860567 |
| AffiniPure Donkey Anti-Mouse IgG (H+L), biotin-SP | Jackson ImmunoResearch | Cat#715-065-151, RRID:AB_2340785 |
| AffiniPure Donkey Anti-Rabbit IgG (H+L), biotin-SP | Jackson ImmunoResearch | Cat#711-065-152, RRID:AB_2340593 |
| Fungal Strains | ||
| Candida albicans | ATCC | Cat# ATCC 90028 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Zombie UV Fixable Viability Dye | Biolegend | Cat# 423108 |
| True-Nuclear™ Transcription Factor Buffer Set | Biolegend | Cat#424401 |
| Cefoperazone sodium salt | Sigma-Aldrich | Cat#C4292 |
| Metronidazole | Sigma-Aldrich | Cat#M1547 |
| Imipenem-Cilasatin sodium salt (1:1 mixture) | Glentham Life Sciences | Cat#GP8148 |
| Vancomycin hydrochloride | Cayman Chemical | Cat#15327 |
| Streptomycin sulfate | Sigma-Aldrich | Cat#S1277 |
| Ampicillin sodium salt | Sigma-Aldrich | Cat#A0166 |
| 5-fluorocytosine | Sigma-Aldrich | Cat#F7129 |
| Fluconazole | Sigma-Aldrich | Cat#F8929 |
| 5-Bromo-2’-deoxyuridine | Sigma-Aldrich | Cat#B5002 |
| Citrate Buffer, pH 6.0, 10X, Antigen Retriever | Sigma-Aldrich | Cat#C9999 |
| Normal Donkey Serum | Jackson ImmunoResearch | Cat#017-000-121, RRID:AB_2337258 |
| Metal Enhanced DAB Substrate Kit | Pierce (ThermoFisher) |
Cat#34065 |
| Vector Methyl Green | Vector Laboratories | Cat#H-3402 |
| Critical Commercial Assays | ||
| Tumor Dissociation Kit, mouse | Miltenyi Biotech | Cat#130-096-730 |
| CD45+ MicroBeads, mouse | Miltenyi Biotech | Cat#130-052-031 |
| QIAamp™ DNA Stool Mini Kit | Qiagen | Cat#51504 |
| DNA Nano LT Kit | Illumina | Cat#20015965 |
| iTaq Universal SYBR Green Supermix | BioRad | Cat#1725122 |
| Vectastain Elite ABC HRP Kit | Vector Laboratories | Cat#PK-6100 |
| Deposited Data | ||
| Sequence reads | Sequence Read Archive | ID: PRJNA496065 |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6J | Jackson Laboratories | RRID:IMSR_JAX:000664 |
| Mouse: C57BL/6NTac Germ-free-Altered Schaedler Flora (ASF)-colonized | Taconic | Cat# B6 GF |
| Oligonucleotides | ||
| Sequencing: ITS1-F (CTTGGTCATTTAGAGGAAGTAA) | Integrated DNA Technologies | Custom primer |
| Sequencing: ITS2-R (GCTGCGTTCTTCATCGATGC) | Integrated DNA Technologies | Custom primer |
| Sequencing: 16S-F (ACTCCTACGGGAGGCAGCAGT) | Integrated DNA Technologies | Custom primer |
| Sequencing: 16S-R (ATTACCGCGGCTGCTGGC) | Integrated DNA Technologies | Custom primer |
| 18S-F (ATTGGAGGGCAAGTCTGGTG) | Integrated DNA Technologies | Custom primer |
| 18S-R (CCGATCCCTAGTCGGCATAG | Integrated DNA Technologies | Custom primer |
| Pan-Candida ITS1-F (GCAAGTCATCAGCTTGCGTT) | Integrated DNA Technologies | Custom primer |
| Pan-Candida ITS1-R (TGCGTTCTTCATCGATGCGA) | Integrated DNA Technologies | Custom primer |
| FungiQuant-F (GGR AAA CTC ACC AGG TCC AG) | Integrated DNA Technologies | Custom primer |
| FungiQuant-R (GSW CTA TCC CCA KCA CGA) | Integrated DNA Technologies | Custom primer |
| FungiQuant probe: 5’-(FAM) TGG TGC ATG GCC GTT (3lABkFQ)-3’ | Integrated DNA Technologies | Custom primer |
| Software and Algorithms | ||
| GraphPad Prism 7 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| Diva | BD Biosciences | http://www.bdbiosciences.com/us/instruments/clinical/software/flowcytometry-acquisition/bd-facsdivasoftware/m/333333/overview |
| FlowJo v10 | Tree Star | https://www.flowjo.com/solutions/flowjo/downloads |
| cutadapt v1.4.1 | cutadapt | https://cutadapt.readthedocs.io/en/stable/guide.html |
| SeqPrep v1.0 | github | https://github.com/jstjohn/SeqPrep |
| QIIME v1.6 | QIIME | http://qiime.org/1.3.0/tutorials/tutorial.html |
| BLAST v2.2.22 | NCBI | https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&DOC_TYPE=Download |
| phyloseq v1.13.3 | github | https://github.com/joey711/phyloseq |
| LEfSe v1.0.7 | Harvard University/ Huttenhower Lab | http://huttenhower.sph.harvard.edu/galaxy/ |
| MaAsLin v0.0.3 | Harvard University/ Huttenhower Lab | http://huttenhower.sph.harvard.edu/galaxy/ |
| SmART Advanced Treatment Planning System | Precision X-Ray | https://pxinc.com/smart-range/ |
| Aperio ImageScope | Leica Biosystems | https://www.leicabiosystems.com/digital-pathology/manage/aperio-imagescope/ |
| Other | ||
| VWR Superfrost Plus Micro Slide | VWR International | Cat#48311-703 |
| Cytoseal Mounting Medium (60) | VWR International | Cat#48212-154 |
| Realplex2 Mastercycler qPCR machine | Eppendorf | N/A |
| LSRII analyzer | BD Biosciences | N/A |
| Mini-Beadbeater-16 | BioSpec | N/A |
| Agilent Bioanalyzer | Agilent Technologies | N/A |
| MiSeq | Illumina | N/A |
| AutoMacs | Miltenyi Biotec | N/A |
| gentleMACS Dissociator | Miltenyi Biotec | N/A |
| Qubit fluorometer | Thermo Fisher Scientific | N/A |
| Aperio AT2 | Leica Biosystems | N/A |