. 2022 Jan 18;11(3):250. doi: 10.3390/plants11030250

Table 3.

Nucleotide sequence of the primers used in the study.

Locus Name	Primer	Sequence (5′-3′)	PCR Program *	Reference
ITS region	ITS4	TCCTCCGCTTATTGATATGC	35 cycles at 94 °C for 30 s, 52 °C for 30 s, 72 °C for 30 s	[43]
ITS region	ITS5	GGAAGTAAAAGTCGTAACAAGG	35 cycles at 94 °C for 30 s, 52 °C for 30 s, 72 °C for 30 s	[43]
TEF1-α	EF1F	TGCGGTGGTATCGACAAGCGT	35 cycles at 94 °C for 30 s, 58 °C for 60 s, 72 °C for 90 s	[44]
TEF1-α	EF1R	AGCATGTTGTCGCCGTT GAAG	35 cycles at 94 °C for 30 s, 58 °C for 60 s, 72 °C for 90 s	[44]
β-tubulin	Bt1a	TTCCCCCGTCTCCACTTCTTCATG	34 cycles at 94 °C for 60 s, 58 °C for 60 s, 72 °C for 60 s	[45]
β-tubulin	Bt1b	GACGAGATCGTTCATGTTGAACTC	34 cycles at 94 °C for 60 s, 58 °C for 60 s, 72 °C for 60 s	[45]

* Initial denaturation at 95 °C for 2 min and the final elongation cycle performed at 72 °C for 10 min, respectively.