Skip to main content
. 2022 Feb 15;11:e70714. doi: 10.7554/eLife.70714

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus; male) BKS(D)-Leprdb/JOrlRj, Leprdb/db diabetic mice Janvier Labs RRID:MGI:6293869
Strain, strain background (Mus musculus; male) C57BL/6JRj Mouse Janvier Labs RRID:MGI:5751862
Strain, strain background (Mus musculus; male) Egln1+/- and wild-type mice Own colony PMID:19217150Mazzone et al., 2009
Cell line (Mus musculus) mIMCD-3 cell line ATCC Cat#:CRL-2123;RRID:CVCL_0429
Transfected construct (M. musculus) siRNA to mouse VHL Qiagen Gene Solution siRNA (Cat#: 1027416) Target sequence: TCCGAGATTGATCTACACATA
Transfected construct (M. musculus) AllStars Negative Control siRNA Qiagen Cat#: 1027280
Antibody anti-HIF-1alpha (Rabbit polyclonal) GeneTex Cat#: GTX127309; RRID:AB_2616089 ICC(1:200)IHC(1:100)
Antibody anti-KIM-1 (Rabbit polyclonal) Novus Biologicals Cat#:NBP1-76701;RRID:AB_11037459 IHC(1:50)WB(1:500)
Antibody Goat anti-Rabbit Secondary Antibody, Alexa Fluor 594 Thermo Fisher Scientific Cat#:A-11037;RRID:AB_2534095 ICC (1:500)IHC (1:500)
Antibody Goat anti-Rabbit Secondary Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat#:A-11008;RRID:AB_143165 IHC (1:500)WB (1:500)
Antibody anti-HIF-1alpha (Rabbit polyclonal) Novus Biologicals Cat#:NB100-479;RRID:AB_10000633 WB: 1:500
Antibody anti-Histone H3 (Rabbit polyclonal) Abcam Cat#: ab1791;RRID:AB_302613 WB: 1:5,000
Antibody anti-α-tubulin (mouse monoclonal) Abnova Cat#:MAB11106; RRID:AB_2888691 WB:1:1,000
Antibody IRDye 800 goat anti-rabbit Secondary Antibody LI_COR Biosciences Cat#:925–32211; RRID:AB_2651127 WB:1:20,000
Antibody IRDye 680 goat anti-mouse Secondary Antibody LI_COR Biosciences Cat#:925–68070; RRID:AB_2651128 WB:1:20,000
Recombinant DNA reagent pCMV3-FLAG-PDK1 Sino Biological Inc Cat#: HG12312-NF Plasmid encoding FLAG-tagged human PDK1
Recombinant DNA reagent pCMV3-GFP-FLAG-PDK1 This paper Plasmid encoding GFP-fused FLAG-tagged human PDK1
Sequence-based reagent Mouse PDK1_F This paper PCR primers AGTCCGTTGTCCTTATGAG
Sequence-based reagent Mouse PDK1_R This paper PCR primers CAGAACATCCTTGCCCAG
Sequence-based reagent Mouse BNIP3_F This paper PCR primers AACAGCACTCTGTCTGAGG
Sequence-based reagent Mouse BNIP3_R This paper PCR primers CCGACTTGACCAATCCCA
Sequence-based reagent Mouse PGK1_F This paper PCR primers AGTCCGTTGTCCTTATGAG
Sequence-based reagent Mouse PGK1_R This paper PCR primers CAGAACATCCTTGCCCAG
Sequence-based reagent MouseSDF-1alpha_F This paper PCR primers GAGAGCCACATCGCCAGAG
Sequence-based reagent MouseSDF-1alpha_R This paper PCR primers TTTCGGGTCAATGCACACTTG
Sequence-based reagent MouseEgln1_F This paper PCR primers GGGCAACTACAGGATAAACGG
Sequence-based reagent Mouse Egln1_R This paper PCR primers CTCCACTTACCTTGGCGT
Sequence-based reagent Mouse GLUT3_F This paper PCR primers TCATCTCCATTGTCCTCCAG
Sequence-based reagent Mouse GLUT3_R This paper PCR primers CCAGGAACAGAGAAACTACAG
Sequence-based reagent MouseACTB_F This paper PCR primers AAGATCAAGATCATTGCTCCTC
Sequence-based reagent MouseACTB_R This paper PCR primers GGACTCATCGTACTCCTG
Sequence-based reagent MouseHMBS_F This paper PCR primers CCTGTTCAGCAAGAAGATGGTC
Sequence-based reagent MouseHMBS_R This paper PCR primers AGAAGTAGGCAGTGGAGTGG
Sequence-based reagent MouseVHL_F This paper PCR primers CATCACATTGCCAGTGTATACCC
Sequence-based reagent MouseVHL_R This paper PCR primers GCTGTATGTCCTTCCGCAC
Commercial assay or kit MycoAlert PLUS mycoplasma detection kit LONZA Cat#:LT07-218
Commercial assay or kit Dual-Luciferase Reporter Assay System Promega Cat#: E1960
Commercial assay or kit Annexin V-FITC / 7-AAD kit Beckman Coulter Cat#: IM3614
Commercial assay or kit Caspase-Glo 3/7 assay kit Promega Cat#: G8091
Commercial assay or kit Quant-iT dsDNA High-Sensitivity Assay Kit Thermo Fisher Scientific Cat#: Q33120
Commercial assay or kit Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific Cat#: 13778075
Commercial assay or kit MitoSOX Red Mitochondrial Superoxide Indicator, for live-cell imaging Thermo Fisher Scientific Cat#:M36008
Commercial assay or kit ProLong Gold Antifade Mountant with DAPI Thermo Fisher Scientific Cat#:P36935
Commercial assay or kit DAPI Thermo Fisher Scientific Cat#:D1306
Commercial assay or kit Hypoxyprobe–1 Omni Kit Hypoxyprobe, Inc Cat#:HP1-XXX
Commercial assay or kit Tyramide Superboost kit Thermo Fisher Scientific Cat#:B40943
Commercial assay or kit OxiSelectTM HNE Adduct Competitive ELISA kit Cell Biolabs STA838
Commercial assay or kit DC Protein Assay BIO-RAD Cat#:5000111
Commercial assay or kit miRNeasy Mini kit Qiagen Cat#:217,004
Commercial assay or kit High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat#:4368814
Commercial assay or kit SYBR Green Master Mix Thermo Fisher Scientific Cat#:4367659
Commercial assay or kit Bradford Protein Assay BIO-RAD Cat#:5000001
Commercial assay or kit In Situ Cell Death Detection Kit Roche Cat#:11684817910RRID:AB_2861314
Commercial assay or kit DCA Microalbumin/Creatinine Urine Test Siemens Healthcare GmbH Cat#:01443699
Chemical compound, drug CPH (1-hydroxy-3-carboxy-pyrrolidine) Noxygen Science Transfer & Diagnostics GmbH Cat#:NOX-01.1–50 mg
Chemical compound, drug EPR-grade Krebs HEPES buffer Noxygen Science Transfer & Diagnostics GmbH Cat#:NOX-7.6.1–500 ml
Chemical compound, drug Deferoxamine Noxygen Science Transfer & Diagnostics GmbH Cat#:NOX-09.1–100 mg
Chemical compound, drug DETC (diethyldithiocarbamate) Noxygen Science Transfer & Diagnostics GmbH Cat#:NOX-10.1–1 g
Chemical compound, drug DMOG (Dimethyloxalylglycine) Frontier Specialty Chemicals Cat#:D1070
Chemical compound, drug cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche Cat#: 11836170001
Chemical compound, drug Formaldehyde solution Sigma Cat#: F8775
Chemical compound, drug Streptozotocin Sigma Cat#: S0130
Chemical compound, drug Sudan Black B Sigma Cat#:199,664
Software, algorithm FlowJo FlowJo RRID:SCR_008520
Software, algorithm Image-Pro Premier v9.2 Media Cybernetics
Software, algorithm ImageJ ImageJ RRID:SCR_003070
Software, algorithm GraphPad Prism GraphPad Prism RRID:SCR_002798
Other Dulbecco’s Modified Eagle’s Medium Thermo Fisher Scientific 31885–023