Skip to main content
. 2022 Jan 25;11:e73330. doi: 10.7554/eLife.73330

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Helicobacter pylori) G27 Baltrus et al., 2009
Strain, strain background (Helicobacter pylori) J99 Alm et al., 1999
Strain, strain background (Helicobacter pylori) Tx30a ATCC 51932
Strain, strain background (Helicobacter pylori) omp27::cat-sacB in NSH57 Yang et al., 2019 H. pylori strain G27 with HopQ deletion
Strain, strain background (Escherichia coli) Rosetta (DE3) pLyS Lab collection E. coli strain for outer membrane IPTG inducible expression of Neisserial Opa proteins
Strain, strain background (Escherichia coli) DH5α Lab collection E. coli strain for maintenance and propagation of pET-28a plasmid constructs
Strain, strain background (Escherichia coli) One Shot Top10 Chemically Competent cells Thermo Fisher Scientific C404010 E. coli strain for cloning, maintenance and propagation of pcDNA3 GFP LIC plasmid constructs
Cell line (Homo sapiens) HEK293T ATCC RRID:CVCL_0063; CRL-3216
Recombinant DNA reagent pET-28a (plasmid) Genscript Plasmid backbone for expression of Neisserial Opa proteins
Recombinant DNA reagent pcDNA3 GFP LIC (plasmid) Addgene RRID:Addgene_30127; #30,127 Plasmid backbone for expression of primate CEACAM1 N-domain constructs in HEK293T cells
Antibody Mouse monoclonal antibody mixture;Mouse α-GFP clones 7.1 and 13.1 Sigma-Aldrich RRID:AB_390913; 11814460001 1:103 dilution; Primary antibody for visualization of GFP labeled CEACAM1 N-domain constructs
Antibody Goat polyclonal antibody; goat α-mouse conjugated to horseradish peroxidase Jackson ImmunoResearch RRID:AB_10015289; 115-035-003 1:104 dilution; Secondary antibody for visualization of GFP labeled CEACAM1 N-domain constructs
Other Advansta WesternBright ECL HRP Substrate Thomas Scientific K-12049-D50 Reagent to visualize proteins bound by secondary antibody in a western blot
Software, algorithm PAML4.9h http://abacus.gene.ucl.ac.uk/software/paml.html Yang, 2007 RRID:SCR_014932
Software, algorithm FUBAR https://www.datamonkey.org Murrell et al., 2013 RRID:SCR_010278
Software, algorithm MEME classic.datamonkey.org Murrell et al., 2012 RRID:SCR_010278
Software, algorithm GARD classic.datamonkey.org Kosakovsky Pond et al., 2006 RRID:SCR_010278
Sequence-based reagent bon_gCCM1N_F3 This paper PCR primer Primer for initial amplification of bonobo CEACAM1 N-domain from genomic DNA [TTCACAGAGTGCGTGTACCC]
Sequence-based reagent bon_gCCM1N_R2 This paper PCR primer Primer for initial amplification of bonobo CEACAM1 N-domain from genomic DNA [CCTCCCAGGTTCAAGCGATT]
Sequence-based reagent bon_gCCM1N_F1 This paper PCR primer Primer for secondary amplification of bonobo CEACAM1 N-domain from genomic DNA [CAGTGGAGGGGTGAAGACAC]
Sequence-based reagent bon_gCCM1N_R1 This paper PCR primer Primer for secondary amplification of bonobo CEACAM1 N-domain from genomic DNA [CATGTTGGTCAGGCTGGTCT]
Sequence-based reagent bon_gCCM1N_seqF1 This paper Sequencing primer Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [CCCGTTTTTCCACCCTAATGC]
Sequence-based reagent bon_gCCM1N_seqF4 This paper Sequencing primer Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [GGGGAAAGAGTGGATGGCAA]
Sequence-based reagent bon_gCCM1N_seqR2 This paper Sequencing primer Primer to sequence bonobo CEACAM1 N-domain amplified from genomic DNA [TGGGGGAATCACTCACGGTA]
Biological sample (pan paniscus) AG05253 Nels Elde RRID:CVCL_1G37 Bonobo genomic DNA sample
Software, algorithm R v4.1.2 https://cran.r-project.org/ RRID:SCR_003005
Software, algorithm Python 3.7 Python Software Foundation https://www.python.org/ RRID:SCR_008394
Software, algorithm JupyterNotebook 5.7.4 Project Jupyter https://jupyter.org/ RRID:SCR_018315
Software, algorithm AnacondaNavigator 1.9.12 Anaconda, Inc https://www.anaconda.com/