FIO1 affects flowering and mRNA m6A levels in Arabidopsis. a) Schematic diagrams show the mutation site in fio1‐1 and the T‐DNA insertion site in fio1‐2 (upper panel) and the methyltransferase domain (green box) in the FIO1 protein (lower panel). Exons in coding sequence and untranslated regions (UTRs) are shown in black and gray boxes, respectively, while introns and other genomic sequences are shown in black lines. fio1‐1 contains a G to A conversion in the last nucleotide in the second intron. b) Semiquantitative RT‐PCR shows the expression of FIO1 in fio1 mutants. TUB2 expression was used an internal control. c) Quantitative real‐time PCR analysis of FIO1 expression in 6‐day‐old seedlings of various genetic background. The expression level of FIO1 in wild‐type seedlings was set as 1.0. Error bars, mean ± SD; n = 3 biological replicates. Asterisk indicates a significant difference between fio1‐2 and wild‐type seedlings (two‐tailed paired Student's t‐test, P < 0.001). d) Loss of FIO1 greatly accelerates flowering under long days. Flowering time of fio1‐1 and fio1‐2 grown under e) long days and f) short days. Error bars, mean ± SD; n = 20. Asterisks indicate significant differences between fio1 mutants and wild‐type plants (two‐tailed paired Student's t‐test, P < 0.001). g) Flowering time distribution of T1 transgenic plants of fio1‐2 gFIO1. The flowering time of each individual T1 transgenic lines of fio1‐2 gFIO1 was scored. h) Measurement of m6A level relative to that of adenosine (m6A/A) by LC‐MS/MS in total RNA (left panel) and mRNA (right panel) isolated from 6‐day‐old wild‐type and fio1‐2 seedlings. The m6A/A ratios in wild‐type seedlings were set as 1.0. Error bars, mean ± SD; n = 3 biological replicates × 3 technical replicates. Asterisks indicate significant differences between fio1‐2 and wild‐type seedlings (two‐tailed paired Student's t‐test, P < 0.01). i) Measurement of m6A level relative to that of adenosine (m6A/A) by LC‐MS/MS in RNA purified from the m6A methylation assay. RNA oligo (GCCAGAGCCAGAGCCAGAGCCAGA) containing four repeats of the consensus m6A motif recognized by FIO1 was incubated with GST, GST‐FIO1, and GST‐mFIO1, after which RNA was purified for measurement of m6A levels by LC‐MS/MS analysis. Error bars, mean ± SD; n = 3 biological replicates. Asterisk indicates a significant difference between GST‐FIO1 and GST or GST‐mFIO1 (two‐tailed paired Student's t‐test, P < 0.01). j) Flowering time of representative fio1‐2 gFIO1 lines (9 and 15) and fio1‐2 gmFIO1 lines (3 and 7) grown under long days. Error bars, means ± SD; n = 20. Asterisks indicate significant differences between the specified genotypes and wild‐type plants (two‐tailed paired Student's t‐test, P < 0.01).