Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Mar 1.
Published in final edited form as: Reprod Toxicol. 2021 Dec 22;108:18–27. doi: 10.1016/j.reprotox.2021.12.008

Prenatal exposure to the phthalate DEHP impacts reproduction-related gene expression in the pituitary

Xiyu Ge 1, Karen Weis 1, Jodi Flaws 2,3, Lori Raetzman 1,3
PMCID: PMC8882145  NIHMSID: NIHMS1769834  PMID: 34954075

Abstract

Phthalates are chemicals used in products including plastics, personal care products, and building materials, leading to widespread contact. Previous studies on prenatal exposure to Di-(2-ethylhexyl) phthalate (DEHP) in mice and humans demonstrated pubertal timing and reproductive performance could be affected in exposed offspring. However, the impacts at the pituitary, specifically regarding signaling pathways engaged and direct effects on the gonadotropins LH and FSH, are unknown. We hypothesized prenatal exposure to DEHP during a critical period of embryonic development (e15.5 to e18.5) will cause sex-specific disruptions in reproduction-related mRNA expression in offspring’s pituitary due to interference with androgen and aryl hydrocarbon receptor (AhR) signaling. We found that prenatal DEHP exposure in vivo caused a significant increase in Fshb specifically in males, while the anti-androgen flutamide caused significant increases in both Lhb and Fshb in males. AhR target gene Cyp1b1 was increased in both sexes in DEHP-exposed offspring. In embryonic pituitary cultures, the DEHP metabolite MEHP increased Cyp1a1 and Cyp1b1 mRNA in both sexes and Cyp1b1 induction was reduced by co-treatment with AhR antagonist. AhR reporter assay in GHFT1 cells confirmed MEHP can activate AhR signaling. Lhb, Fshb and Gnrhr mRNA were significantly decreased in both sexes by MEHP, but co-treatment with AhR antagonist did not restore mRNA levels in pituitary culture. In summary, our data suggest phthalates can directly affect the function of the pituitary by activating AhR signaling and altering gonadotropin expression. This indicates DEHP’s impacts on the pituitary could contribute to reproductive dysfunctions observed in exposed mice and humans.

Keywords: Pituitary, DEHP, Endocrine-disrupting Chemicals, Reproduction, AhR

1. Introduction

Di(2-ethyl-hexyl) phthalate (DEHP) is one of the most prevalent phthalates, used as a plasticizer and industrial solvent. DEHP can be found in various products including PVC materials, food containers, personal-care products, cosmetics, and medical devices. Humans and other animals are constantly exposed to DEHP on a daily basis and it can enter human bodies through different paths including ingestion, inhalation and dermal contact [1].

DEHP is defined as an endocrine disrupting chemical (EDC) due to its ability to cause endocrine dysfunction in humans and other animals [2,3]. Alteration in reproductive function is one of the most common effects of DEHP as an EDC [4,5]. In males, DEHP can have anti-androgenic effects and cause testicular-dysgenesis-like syndromes (TDS) including decreased anogenital distance (AGD), reduction in testosterone production, and alterations in sexual differentiation [6-8]. These effects are consistent with effects of exposure to other anti-androgens such as flutamide [9], indicating that DEHP could affect androgen-mediated biological process. In females, DEHP can suppress estradiol production in the ovary [10] and accelerate reproductive aging [11].

Humans and animals are constantly exposed to DEHP throughout life but the prenatal period is thought to be one of the critical windows during which DEHP exposure can cause more serious consequences. In male rodents, prenatal exposure to DEHP could affect spermatogenesis and sperm DNA methylation [12] and induce premature reproductive senescence, decreased fertility, decreased semen quality and mobility [13]; in females, the exposure could lead to abnormal follicular development [5,14], disrupted estrous cyclicity and folliculogenesis, early onset of puberty and decreased fertility-related indices [15]. Some effects can be passed on to the offspring in a transgenerational manner [14]. As for hormone changes, decreased Follicle Stimulating Hormone (FSH), Inhibin B and testosterone levels, as well as increased Luteinizing Hormone (LH) and estradiol levels were found in offspring [14]. Even though multiple findings suggest a correlation between prenatal DEHP exposure and reproductive function disruptions, the molecular mechanisms showing how DEHP exposure could cause those disruptions are unknown. Also, effective interventions that could reverse the negative effects of DEHP have not been found.

The reproductive system in humans and rodents is regulated by Hypothalamic-Pituitary-Gonadal (HPG) axis [16]. Studies have found that prenatal exposure to DEHP could cause alterations in both the hypothalamus and pituitary. Specifically, in utero and lactational DEHP exposure in mice significantly increased gonadotropin gene expression in male and female offspring when examined in adulthood [17]. A similar exposure period in rats caused a decrease in estrogen receptor (ER)α and β expression in prepubertal and adult female pituitary [18]. Despite this mounting evidence showing that DEHP impacts HPG axis function during development, no studies have looked directly at the developing pituitary to determine direct effects, especially with lower doses of DEHP. Additionally, little is known about how DEHP could directly affect the pituitary gland through mechanisms other than its anti-androgenic effects.

Limited data suggest that DEHP, together with other groups of phthalates, can be weak agonists of aryl hydrocarbon receptor (AhR) and can activate AhR in multiple cell types of humans or rodents [19]. AhR is a transcription factor that is thought to function primarily as a sensor of environmental toxicants. AhR signaling activates the downstream transcription of genes including Cyp1a1, Cyp1b1 and Cyp1a2 [20] that are cytochrome P450s enzymes which are involved in the degradation, metabolism and excretion of toxicants. AhR signaling could be activated by a range of ligands in different categories including halogenated aromatic hydrocarbons (HAHs) like 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, dioxin), non-halogenated polycyclic aromatic hydrocarbons like β-naphthoflavone, and polychlorinated biphenyls (PCBs) [21]. DEHP or its primary metabolite- MEHP could induce AhR signaling in vivo in transgenic zebrafish [22], as well as in mouse ovarian granulosa cells [23], In in vitro experiments, DEHP modestly induced an AhR reporter luciferase expression vector in Hepa1.12cR cells [24]. However, there have not been any studies showing activation of AhR in the pituitary gland in vivo or in vitro by DEHP, and more specifically, how it could affect reproductive related gene expression.

It is known that AhR signaling impacts the pituitary gland. The AhR signaling pathway is crucial for maintaining the normal reproductive functions of the pituitary gland, as gonadotropin mRNA expression in the pituitary was significantly decreased in AhRKO mice [25]. Other than its endogenous functions, AhR activation with TCDD has been known to be able to decrease gonadotropin expression in both male and female rodents [25], and activation with agonist β-naphthoflavone was found to reduce the expression of Ahr and Prl mRNA in GH3 cells [27]. There are also contradictory findings in ovariectomized female mice- an increase in Cga, Lhb and Esr1 mRNA levels were caused by TCDD exposure [28]. Although plenty of studies showed the impacts of AhR activation on the reproductive-related functions in the pituitary, most of them only focused on traditional AhR agonists such as TCDD or β-naphthoflavone. Little is known about the effects of other possible AhR agonists, like DEHP, on the pituitary.

In this study we aimed to 1) determine the effects of developmental exposure to DEHP on pituitary gonadotropes and its relationship to androgen signaling; 2) elucidate the direct effects of DEHP and its primary metabolite, MEHP, on the pituitary, and examine the impact of DEHP on AhR signaling and the possible relationship between AhR and gonadotropin regulation. We performed dosing experiments, embryonic pituitary explant culture and dual-luciferase reporter assay, which provided us both in vivo and in vitro evidence to explore DEHP’s impacts on reproductive function.

2. Materials and Methods

2.1. Mice

CD-1 mice were originally obtained from Charles River and were bred in house at the animal facility of the University of Illinois Urbana-Champaign for all experiments described. Sex was confirmed by visual inspection and SRY genotyping of the tail using the primer sequences listed in table 1. The University of Illinois Urbana-Champaign Institutional Animal Care and Use Committee approved all procedures.

*Table 1.

PCR primers used in this study

Gene Forward Sequence 5’-3’ Reverse sequence 3’-5’
Ppia CAAATGCTGGACCAAACACAAACG GTTCATGCCTTCTTTCACCTTCCC
Sry TGCAGCTCTACTCCAGTCTTG GATCTTCATTTTTAGTGTTC
Cyp1a1 GTCCCGGATGTGGCCCTTCTCAAA TAACTCTTCCCTGGATGCCTTCAA
Cyp1b1 AATGAGGAGTTCGGGCGCACA GGCGTGTGGAATGGTGACAGG
Fshb TGGTGTGCGGGCTACTGCTAC ACAGCCAGGCAATCTTACGGTCTC
Gnrhr ATGATGGTGGTGATTAGCC ATTGCGAGAAGACTGTGG
Lhb CCCAGTCTGCATCACCTTCAC GAGGCACAGGAGGCAAAGC
Open in a new tab

2.2. In vivo dosing and pituitary collection

Timed-pregnant CD-1 mice were randomly divided into 3 different dosing groups: control, flutamide and DEHP group, each group contains 5-7 dams. Starting from gestational day 15.5 until 18.5, each mouse received a daily dose orally through consumption of chemicals dissolved in tocopherol stripped corn oil from a pipet tip at the same time every day. The time period e15.5-e18.5 was selected because male mice have a prenatal testosterone surge which is critical for gonad and sexually dimorphic development [29]. This testosterone surge starts at embryonic day 15.5 and studies have shown that blocking this testosterone surge by exposing males prenatally with anti-androgens could affect gonadotropin expression in males and make them female-like [9]. The doses in flutamide (Tocris) and DEHP (Sigma) group were 10 mg/day and 200 μg/kg/day, respectively; the control group received 10 μL DMSO. The dosage of flutamide was picked based on a previous paper showing effects on pituitary gonadotropins [9]. The dosage of DEHP, 200 μg/kg/day, was chosen because it is the dosage that is closest to human daily exposure range (DEHP TDI: ~50μg/kg/day) and also had reproductive outcomes in both male and female offspring [15]. The whole pituitary gland was taken out from offspring on the day of birth (P0) and preserved in RNAlater (Thermo-Fisher) at −20 °C.

2.3. Anogenital distance and weight measuring

Anogenital distance (AGD) and body weight were measured using a caliper and an electronic scale, respectively. The AGDs were normalized to body weight for analysis.

2.4. In vitro pituitary culture

Embryos from CD-1 mice were taken out of the uterus on embryonic day 16.5 and tissue from each embryo was collected for SRY genotyping for sex determination. The whole pituitary glands were taken out and transferred to 96-well plate with 50μL phosphate buffered saline (PBS) +1% antibiotic/antimycotic solution (anti-anti, Thermo-Fisher). Pituitaries were washed twice with PBS +1% anti-anti and 50 μL of media (phenol red-free DMEM/F12 (Thermo-Fisher), supplemented with 10% charcoal-stripped fetal bovine serum (Sigma-Aldrich) and 1% anti-anti) with different treatments (0.1 μg/mL, 1 μg/mL, 10 μg/mL and 100 μg/mL MEHP/DEHP (Sigma) added to each well. The concentrations of MEHP/DEHP were picked based on previous papers describing mouse ovarian cultures with MEHP/DEHP [30,31]. Pituitaries were cultured at 37 °C for 72 hours without changing the media. To co-treat the pituitary with MEHP and AhR antagonist- CH223191 (ApexBio), pituitaries were harvested and washed as described above and first treated with the antagonist dissolved in DMSO in the 37 °C incubator for 2 hours, then MEHP was added at the final concentration of 100 μg/mL. Some pituitaries were only treated with the antagonist to eliminate possible effects of the antagonist. The final concentration of the AhR antagonist was at 1μM as instructed by the manufacturer’s product catalog.

2.5. RNA preparation and cDNA preparation

Pituitaries from both the in vivo and in vitro experiments were homogenized and RNA was isolated using the RNAqueous-Micro kit (Invitrogen). Total RNA was reverse-transcribed according to the manufacturer’s instructions using the ProtoScript Strand cDNA Synthesis kit (New England Biolabs) as previously described [32].

2.6. Quantitative real-time polymerase chain reaction (qRT-PCR)

Pituitaries from in vivo experiments (n = 5-7) or culture from in vitro experiments (n = 6-22), were subjected to qPCR for mRNA analysis of specific genes. Oligonucleotide primers for Ahr, Gnrhr, Lhb, Fshb, Prl, Cyp1a1 and Cyp1b1 (Life Technologies, primer sequence see Table 1) were used to amplify gene-specific transcripts by qPCR. The expression levels of genes of interest were normalized to Ppia mRNA levels. Ppia is a stable housekeeping gene for qRT-PCR normalization[33] that we confirmed had consistent expression levels across different treatments both in vivo and in vitro. The data were analyzed using the standard comparative cycle threshold value method (2–ΔΔCt) [34].

2.7. Transfection and dual-luciferase reporter assay

Immortalized pituitary progenitor cell line GHFT1 cells [35](kindly used with permission from Dr. Pamela Mellon) were maintained in DMEM media with phenol red (Thermo-Fisher), supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin-streptomycin (Fisher). Cells were plated in 24-well plate and transfected at ~70% confluency. 500 ng AhR reporter construct (Cignal) and 10 ng renilla control reporter construct (Cignal) were transfected in each well with 1.5 uL Lipofectamine 2000 (Invitrogen) as transfection reagent and Opti-MEM (Thermo-Fisher) as transfection media. After 6 hours of transfection, media was replaced and fresh phenol red-free DMEM/F12 media (Thermo-Fisher), supplemented with 10% charcoal-stripped fetal bovine serum (Sigma-Aldrich) and 1% anti-anti with different treatments was added. Treatments consisted of 100 μg/mL MEHP, 10nM TCDD or DMSO as the control treatment. After 12-hour treatment, cells were lysed and dual-luciferase assay system (Promega) was performed according to manufacturer’s instructions. Relative luciferase units (RLU) were detected using a luminometer (High-Throughput Screening Facility, UIUC) and normalized to renilla RLU.

2.8. Statistical analysis

For in vivo experiments, male and female offspring were analyzed separately and data from multiple pups in one litter were averaged to one data point and each litter was considered as one unit statistically. For in vitro experiments, each pituitary in one culture was considered as one data point and at least three culture experiments were performed.

All data are presented as mean + / − SEM. Statistical significance was determined using two-way (in vivo) or one-way (in vitro) ANOVA followed by Tukey’s multiple comparisons test or Dunnett’s multiple comparisons test. P values less than 0.05 were considered significant. All analyses were performed using Graph Pad Prism 8.2.1.

3. Results

3.1. Gonadotropin gene expression is affected by DEHP or MEHP in the developing pituitary

To determine if DEHP interferes with testosterone signaling, we focused dosing on the period of testosterone surge in male mice (e15.5 to e18.5) and collected offspring at PND 0. We also used a known anti-androgen, flutamide, to compare to the effects of DEHP.

We measured the anogenital distance (AGD) of the offspring (Fig 1) right before collecting the pituitaries because AGD is reflective of testosterone levels. We found no significant change in AGD normalized to body weight in both male and female offspring exposed to DEHP. However, as expected, male offspring treated with flutamide had a significant decrease in AGD/BW compared to control group.

Figure 1.

Figure 1.

Open in a new tab

Anogenital distance (AGD) normalized to body weight (BW) of offspring at P0. Different columns refer to control, flutamide and DEHP treatment, respectively. AGD/BW was calculated, and the graph represents the mean +/− SEM (n = 4-6/treatment group). Two-way ANOVA followed by Tukey’s multiple comparison’s test was done. Asterisk (*) represents significant difference from vehicle control, Two-way ANOVA P = 0.0155, *P<0.05 by Tukey’s multiple comparison’s test.

We then looked at mRNA expression changes of gonadotropin and related genes in the offspring and found DEHP exposure significantly increased the mRNA level of follicle stimulating hormone subunit beta (Fshb) in males only (Fig 2, B). However, the induction was not observed for luteinizing hormone subunit beta (Lhb) in either sex (Fig 2, A). Flutamide successfully increased expression levels of both Lhb and Fshb in males, and as expected, it had no effect on females due to female’s lack of prenatal androgen surge (Fig 2, A-B). We also examined the expression of gonadotropin releasing hormone receptor (Gnrhr) mRNA and found no significant change caused by either DEHP or flutamide in both sexes (Fig 2, C).

Figure 2.

Figure 2.

Open in a new tab

Pituitary gene expression changes in gonadotropes of offspring in response to DEHP exposure. mRNA fold changes of Lhb (A), Fshb (B) and Gnrhr (C) are graphed relative to male controls. Different columns refer to control, flutamide and DEHP treatment, respectively. The graph represents the mean +/− SEM (n = 5-7/treatment group). Two-way ANOVA followed by Tukey’s multiple comparison’s test was done. Asterisk (*) represents significant difference from male vehicle control, Two-way ANOVA P = 0.0172 (A), 0.0158 (B), *P<0.05, ****P<0.005, ****P<0.0001 by Tukey’s multiple comparison’s test

To further explore whether DEHP could directly cause those changes described above at the level of the pituitary, we conducted in vitro embryonic pituitary culture experiments and checked gonadotropins and related gene expression changes in cultured pituitaries. Cultures were treated with DEHP’s primary metabolite MEHP because there is a lack of metabolic machinery to convert DEHP to MEHP in the in vitro setting [30]. In contrast to in vivo experiments, both Lhb (Fig 3, A-B) and Fshb (Fig 3, C-D) mRNA levels were significantly decreased when treated with 100 μg/mL MEHP in both male (Fig 3, A, C) and female (Fig 3, B, D) pituitaries. As for Gnrhr mRNA, there is no significant difference caused by MEHP treatment only with a trend of decrease at the highest concentration (100 μg/mL). Taken together, these data demonstrate that both in vivo and directly at the embryonic pituitary, DEHP can affect gonadotropin mRNA production.

Figure 3.

Figure 3.

Open in a new tab

Pituitary gene expression changes in gonadotropes from in vitro culture experiment. mRNA fold changes of Lhb (A-B), Fshb (C-D) and Gnrhr (E-F) are presented with males and females separated. Different columns refer to concentration of MEHP as marked. The graph represents the mean +/− SEM (n = 5-12/treatment group). One-way ANOVA followed by Dunnett’s multiple comparison’s test was done. One-way ANOVA P = 0.0397 (A), P < 0.0001 (B-D), #: P = 0.053 (E). Asterisk (*) represents significant difference from vehicle control, *P<0.05, ****P<0.0001 by Dunnett’s multiple comparisons test

3.2. AhR downstream genes were induced with both in vivo and in vitro exposure to DEHP or MEHP

To determine if DEHP engaged AhR signaling in the pituitary, we looked at mRNA levels of Cyp1a1 and Cyp1b1, two genes that are transcriptionally increased by AhR signaling. We found no change in Cyp1a1 (Fig 4, A) mRNA levels but a significant increase in Cyp1b1 (Fig 4, B) mRNA in both sexes to similar levels. Interestingly, flutamide had no effect on both genes in either sex. For the in vitro culture experiment, since we found no baseline difference between male and female Cyp1a1 or Cyp1b1 genes, we combined the data of both sexes when analyzing. Both 0.1 and 100 μg/mL treatment of MEHP caused a significant increase in Cyp1a1 mRNA level (Fig 5, A), while Cyp1b1 mRNA level was significantly increased by 10 and 100 μg/mL treatment (Fig 5, B). We also treated the pituitaries with DEHP and examined the expression change of both genes and found no change caused by DEHP at the two higher concentrations (Fig 5, C-D), which confirmed that in vitro, MEHP was the chemical that exerted the effects directly at the pituitary. In all, these data show that DEHP/MEHP can likely signal through AhR in the embryonic pituitary.

Figure 4.

Figure 4.

Open in a new tab

Pituitary gene expression changes of AhR downstream genes in offspring. mRNA fold changes of Cyp1a1 (A) and Cyp1b1 (B) are presented with males and females separated. Different columns refer to control, flutamide and DEHP treatment, respectively. The graph represents the mean +/− SEM (n = 5-7/treatment group). Two-way ANOVA followed by Tukey’s multiple comparison’s test was done. Asterisk (*) represents significant difference from vehicle control, Two-way ANOVA P < 0.0001 (B), **P<0.005 by Tukey’s multiple comparison’s test

Figure 5.

Figure 5.

Open in a new tab

Pituitary gene expression changes of AhR downstream genes from in vitro culture experiment. mRNA fold changes of Cyp1a1 (A, C) and Cyp1b1 (B, D) are presented with males and females combined. Different columns refer to treatment of MEHP (A-B) and DEHP (C-D) as marked. The graph represents the mean +/− SEM (n = 8-22/treatment group in A and B, n = 4-8/treatment group in C and D). One-way ANOVA followed by Dunnett’s multiple comparison’s test was done. One-way ANOVA P <0.0001 (A-B). Asterisk (*) represents significant difference from vehicle control, *P<0.05, ***P<0.0005, ****P<0.0001 by Dunnet’s multiple comparisons test

To confirm whether the induction of Cyp1a1 and Cyp1b1 mRNA by MEHP occurs through the AhR signal pathway, we co-treated the pituitary explants with MEHP and AhR antagonist- CH223191 and checked whether the induction could be reversed (Fig 6). The induction of Cyp1a1 mRNA was not blocked by the antagonist as no significant difference between the MEHP and MEHP + antagonist treatment group was found, and both are significantly increased compared to control group (Fig 6, A). In addition, the treatment of AhR antagonist alone significantly decreased Cyp1a1 expression. As for Cyp1b1 (Fig 6, B), the co-treatment of AhR antagonist with MEHP successfully brought the mRNA level back to the level of control. Interestingly, the antagonist-alone treatment did not affect Cyp1b1 mRNA. Taken together, these studies demonstrate that the induction of Cyp1b1 by MEHP was indeed mediated through activation of AhR signaling.

Figure 6.

Figure 6.

Open in a new tab

Pituitary gene expression changes of AhR downstream genes from in vitro culture experiment co-treated with AhR antagonist. mRNA fold changes of Cyp1a1 (A) and Cyp1b1 (B) are presented with males and females combined. Different columns refer to treatment of MEHP and/or AhR antagonist (anta) CH223191 as marked. The graph represents the mean +/− SEM (n = 9-10/treatment group). One-way ANOVA followed by Tukey’s multiple comparison’s test was done. One-way ANOVA P < 0.0001. Asterisk (*) represents significant difference from vehicle control or from other treatment group as indicated. *P<0.05, **P<0.005, ***P<0.0005, ****P<0.0001 by Tukey’s multiple comparison’s test.

3.3. MEHP directly activates AhR as shown by AhR reporter assay

To further determine whether MEHP could directly activate AhR signaling, we performed an AhR reporter assay with a reporter construct containing xenobiotic response element (XRE) linked to luciferase in the immortalized pituitary progenitor cell line GHFT1. We observed MEHP treatment at the concentration of 100 μg/mL significantly induced the luciferase activity compared to DMSO treatment as control. We also treated the cells with TCDD as positive control to guarantee a functional AhR reporter construct (Fig 7). These data confirmed MEHP could activate AhR signaling in the pituitary and induce transcription through XRE.

Figure 7.

Figure 7.

Open in a new tab

AhR reporter assay. Normalized luciferase activity in cells treated with 100 μg/mL MEHP or 10 nM TCDD were compared to DMSO as the control treatment. The graph represents the mean +/− SEM (n = 4-6/treatment group). One-way ANOVA followed by Dunnett’s multiple comparison’s test was done. One-way ANOVA P = 0.0066. Asterisk (*) represents significant difference from DMSO control *P<0.05, **P<0.005 by Dunnett’s multiple comparison’s test.

3.4. The decrease of gonadotropin genes in vitro was not directly caused by activation of AhR signaling

Next, we examined the expression change of gonadotropins and related genes when co-treated with AhR antagonist in order to find out whether there is direct association between the activation of AhR signaling and decrease in gene expression (Fig 8). For all three genes- Lhb (Fig 8, A-B), Fshb (Fig 8, C-D) and Gnrhr (Fig 8, E-F), co-treatment with AhR antagonist did not bring the mRNA back to control levels; there is no significant difference between MEHP alone and MEHP + antagonist treatment group. This suggests that even though the AhR was activated by MEHP, and MEHP caused the decrease of gonadotropin genes at the level of pituitary, there is no direct association between these two effects.

Figure 8.

Figure 8.

Open in a new tab

Pituitary gene expression changes of gonadotropes from in vitro culture experiment co-treated with AhR antagonist. mRNA fold changes of Lhb (A-B), Fshb (C-D) and Gnrhr (E-F) are presented with males and females separated. Different columns refer to treatment of MEHP and/or AhR antagonist (anta) CH223191 as marked. The graph represents the mean +/− SEM (n = 6-8/treatment group). One-way ANOVA followed by Tukey’s multiple comparison’s test was done. One-way ANOVA P = 0.0054 (A), 0.0134 (B), 0.0067 (C), 0.0005 (D), 0.0017 (E), 0.0001 (F). Asterisk (*) represents significant difference from vehicle control or from other treatment group as indicated. *P<0.05, **P<0.005, ***P<0.0005. #: Control vs. 100 μg/mL MEHP, P=0.067 by Tukey’s multiple comparison’s test.

4. Discussion

DEHP has anti-androgenic effects on male rodents through possible molecular mechanisms including interfering with cholesterol transport and steroidogenesis in the testis [36]. In this study we investigated possible anti-androgenic effects of DEHP on prenatally exposed offspring, specifically focusing on impacts at the pituitary and reproductive gene expression. Compared to the potent anti-androgen, flutamide, DEHP at the dose of 200 μg/kg/day did not significantly affect ADG- a toxicological marker for fetal androgen action [37] of the offspring. However, this could be due to the relatively lower dosage and the shorter dosing period (e15.5 through e18.5) we chose, or could also be due to the age that we chose to measure for the offspring (PND 0) since previous studies showed a higher dosage (750 mg/kg/day) with longer dosing period (e10.5 through e18.5) of DEHP could decrease the male AGD at the ages of PND 21 and 16 months [13]. Another difference may be mechanism of action. DEHP acts by interfering with the regulation of steroidogenesis [38] while flutamide acts as an androgen receptor antagonist [39].

Even though no significant anti-androgenic impact of DEHP on prenatal exposed offspring was found at the physiological level, evidence indicating that DEHP could impact androgen signaling was found at the molecular level- a significant increase of Fshb mRNA level was found only in male offspring exposed to DEHP. This change of Fshb caused by DEHP was consistent with the impact of flutamide and is similar to another study showing exposure to flutamide during the testosterone surge increases Fshb in males [9].

Interestingly, Lhb was not affected by DEHP, which is often thought to be correlated with Fshb and they were expected to change in a similar way as they are both regulated by steroid hormones in a negative-feedback loop. This indicates that more than one mechanism could be involved in regulating these two gonadotropin genes in response to DEHP which caused them to change differently. Transcription of both Lhb and Fshb could be regulated by GnRH pulsatility- higher pulse frequency favors Lhb while lower frequency favors Fshb [40]. Future studies should examine GnRH pulsatility in detail and explore whether DEHP exposure is associated with GnRH pulsatility changes. Besides, transcription of Fshb could also be regulated independently by an activin-follistatin-inhibin loop: activin released by gonads upregulates Fshb while inhibin and follistatin downregulate it [41]. In a previous study, it has been found that prepubertal male offspring exposed to DEHP during gestation and lactation had significantly decreased serum inhibin B [42], and this could be a possible explanation for the increase of Fshb found in our study. Future experiments should examine possible changes of activin, inhibin and follistatin after DEHP exposure to better understand the in vivo mechanisms regulating Fshb’s expression change caused by DEHP.

We saw a decrease in both Lhb and Fshb mRNA in the pituitary explant culture experiment treated with 100 μg/mL MEHP These opposite results compared to in vivo data indicate that different mechanisms regulating the expression of gonadotropins other than androgen signaling and the negative feedback loop through HPG axis could be involved when the body is exposed to DEHP/MEHP. One possible mechanism that we considered was the AhR signaling pathway since it is related to metabolism of toxicants in the body and it is also active in the pituitary [20,43]. DEHP has been known as a weak agonist of AhR [19] and activation of AhR by DEHP has been found in different organisms [19,22,25]. Specifically, when it comes to AhR activation and gonadotropin regulation, decreased Lhb and Fshb mRNA level and serum level of LH and FSH were observed in mice with the AhR signaling pathway activated developmentally [26,44]. These findings are consistent with our in vitro culture experiment results but are not reflected by our in vivo experiments. This suggests that in contrast to DEHP/MEHP’s antiandrogenic effects that are likely exerted through the HPG axis, activation of the AhR signaling pathway by DEHP/MEHP directly at the pituitary is associated with decreased gonadotropin gene expression.

We demonstrated induction of AhR downstream genes Cyp1a1 and Cyp1b1 by MEHP in vitro, however, we observed a more complicated expression change of these two genes in vivo. Both male and female offspring from the in vivo experiment had an increase in Cyp1b1 mRNA level after being exposed to DEHP prenatally, while the Cyp1a1 remained unchanged. The induction of Cyp1b1 mRNA was consistent with our hypothesis that AhR was activated by DEHP. However, a possible explanation for upregulated Cyp1b1 and unchanged Cyp1a1 in vivo is that there might be other mechanisms involved that downregulated Cyp1a1, which counteracted the induction of Cyp1a1 by AhR activation after DEHP exposure. It has been known that 17β-estradiol could reduce only Cyp1a1 but not Cyp1b1 expression at the transcriptional level by squelching available nuclear factor-1 in human endometrial cells [45]. Future studies could focus more specifically on the relationship between DEHP activation and its effects on estrogen and estrogen receptor regulation and possible association with AhR or other signaling pathways. Even though in vivo experiments showed only Cyp1b1 mRNA was induced by DEHP exposure, both Cyp1a1 and Cyp1b1 mRNA were found increased by MEHP in the in vitro culture experiment. Interestingly, we saw a nonmonotonic dose-response curve in Cyp1a1 mRNA levels, marked by higher level of Cyp1a1 expression in pituitaries treated with 0.1 μg/mL MEHP compared to 1 and 10 μg/mL MEHP. Nonmonotonic dose effects are often observed in response to EDC exposures [46]. Further, prenatal exposure to DEHP has been reported to have nonmonotonic dose effects on testicular and serum testosterone and AGD in male mice [47]. Although the mechanisms causing the nonmonotonic dose effects are still unknown, our findings showing nonmonotonic dose effects on Cyp1a1 in response to MEHP treatment could be crucial for future studies on the effects of exposure to phthalates, especially environmentally relevant low-dose exposures. Besides, the absence of nonmonotonic dose effects on Cyp1b1 is another indication that multiple mechanisms could be involved in regulating Cyp1a1 and Cyp1b1 expression in the pituitary in response to DEHP/MEHP exposure. These findings above confirmed that MEHP could directly impact the pituitary and the comparison to DEHP treatment showed that at the pituitary, DEHP could only exert its effects after being metabolized to MEHP. The different changes of Cyp1a1 in vitro compared to in vivo also indicated that multiple mechanisms are likely to be involved when the body was exposed to DEHP and the effects through other mechanisms could be opposite to the direct effects at the pituitary.

We discovered the induction of Cyp1b1, but not Cyp1a1, by MEHP could be blocked by cotreatment with an AhR antagonist. One possible explanation for the antagonist not being able to block the Cyp1a1 induction by MEHP was that the induction might be mediated through the combination of AhR and other signaling pathways. One candidate that could be considered is the peroxisome proliferator-activated receptors (PPARs), which are ligand activated nuclear receptors that function as transcription factors to regulate gene expression in response to endogenous and exogenous ligands [48]. MEHP/DEHP is considered a ligand of PPARs and it has been known to be able to disrupt male and female reproductive tract through PPARs [49]. PPARs have been reported to be expressed in the pituitary [50-52] and could induce Cyp1a1 expression independent from AhR pathway [53]. Thus, PPAR signaling pathway could be one of the directions to investigate to understand the induction of Cyp1a1 and DEHP exposure for future study. It is also possible that the AhR antagonist could have ligand or target gene selective effects. For example, CH223191 was reported to have preferential inhibitory effects on HAHs-type ligands like TCDD, but have little effect on BNF and PAHs [54]. Another interesting finding was that the AhR antagonist alone was able to decrease Cyp1a1 mRNA expression in the absence of MEHP. This suggests that the basal level of Cyp1a1 expression could be decreased by the presence of AhR antagonist and the unchanged Cyp1a1 in response to AhR antagonist indicated the possible involvement of different mechanisms in regulation of Cyp1a1 and Cyp1b1.

Because we saw an inconsistent response of Cyp1a1 and Cyp1b1 to AhR antagonist, we further explored the activation of AhR by MEHP using an AhR reporter assay. We demonstrated MEHP directly activates AhR signaling in the pituitary by showing significant increases in normalized luciferase activity in GHFT1 cells treated with MEHP. The induction was not as strong as that elicited by TCDD, suggesting DEHP/MEHP have a reduced ability to induce AhR signaling compared to the prototypical ligand. Taken together, these data suggest that DEHP/MEHP can contribute to regulation of AhR target genes, although they make act as selective receptor modulators on specific genes such that Cyp1b1 is more responsive than Cyp1a1.

To determine whether the decrease of gonadotropins and Gnrhr was directly associated with the activation of AhR, we examined the mRNA levels of Lhb, Fshb, and Gnrhr in pituitaries co-treated with MEHP and AhR antagonist and found the co-treatment with antagonist did not restore the expression levels of these three genes. This finding showed us that the activation of AhR was not the direct cause of decrease in gonadotropin-related genes and also suggested that alternative pathways need to be discovered to determine the molecular mechanisms regulating the gonadotropin-related gene expression at the pituitary. PPARs mentioned earlier are one of the possible mechanisms since a previous study reported that PPAR agonists could directly suppress the gonadotropin transcription in mouse gonadotrope LβT2 cells [55]. Besides, DEHP was also reported to be related to immune responses [56,57] and oxidative stress [58] and these factors could potentially play roles in the regulation of gonadotropins. In order to understand those possible mechanisms, future studies on the immune response and oxidative stress signaling specifically at the pituitary in response to DEHP exposure are needed.

In summary, our study showed that DEHP/MEHP could directly impact gonadotropin gene expression at the pituitary, and multiple mechanisms are likely involved in the regulation of gonadotropin genes in response to DEHP/MEHP exposure since different results were found from in vivo and in vitro experiments. AhR signaling pathway is one of the mechanisms that could be the mediator of gonadotropin regulation, however, no direct association was found between the AhR activation and decrease in gonadotropins. These results suggest the need for more extensive research on DEHP/MEHP’s impact at the pituitary and other mechanisms associated with DEHP exposure and gonadotropin regulation.

Highlights.

  • Prenatal exposure to DEHP increased Fshb mRNA only in male pituitaries

  • Prenatal exposure to DEHP increased Cyp1b1 mRNA in male and female pituitaries

  • MEHP increased both Cyp1a1 and Cyp1b1 mRNA in embryonic pituitary culture

  • An AhR inhibitor reversed MEHP induced Cyp1b1 but not Cyp1a1 expression

  • MEHP induced AhR transcription through XRE in GFHT1 cells

Acknowledgements

The authors would like to thank members of the Flaws laboratory for experimental advice and providing reagents including AhR antagonist, TCDD and AhR reporter construct. This work was supported by NIH R01 ES032163.

Footnotes

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • [1].Staples CA, Peterson DR, Parkerton TF, Adams WJ, The environmental fate of phthalate esters: A literature review, Chemosphere. (1997). 10.1016/S0045-6535(97)00195-1. [DOI] [Google Scholar]
  • [2].Adibi JJ, Perera FP, Jedrychowski W, Camann DE, Barr D, Jacek R, Whyatt RM, Prenatal exposures to Phthalates among women in New York and Krakow, Poland, Environmental Health Perspectives. (2003). 10.1289/ehp.6235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Martinez-arguelles DB, Campioli E, Culty M, Zirkin BR, Papadopoulos V, Fetal origin of endocrine dysfunction in the adult : The phthalate model, Journal of Steroid Biochemistry and Molecular Biology. 137 (2013) 5–17. 10.1016/j.jsbmb.2013.01.007. [DOI] [PubMed] [Google Scholar]
  • [4].Kay VR, Bloom MS, Foster WG, Reproductive and developmental effects of phthalate diesters in males, Critical Reviews in Toxicology. 44 (2014) 467–498. 10.3109/10408444.2013.875983. [DOI] [PubMed] [Google Scholar]
  • [5].Zhou C, Gao L, Flaws JA, Exposure to an environmentally relevant phthalate mixture causes transgenerational effects on female reproduction in mice, Endocrinology. (2017). 10.1210/en.2017-00100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Hu G, Lian Q, Ge R, Hardy DO, Li X, Phthalate-induced testicular dysgenesis syndrome : Leydig cell influence, (2009) 139–145. 10.1016/j.tem.2008.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Swan SH, Main KM, Liu F, Stewart SL, Kruse RL, Calafat AM, Mao CS, Redmon JB, Ternand CL, Sullivan S, Teague JL, Drobnis EZ, Carter BS, Kelly D, Simmons TM, Wang C, Lumbreras L, Villanueva S, Diaz-Romero M, Lomeli MB, Otero-Salazar E, Hobel C, Brock B, Kwong C, Muehlen A, Sparks A, Wolf A, Whitham J, Hatterman-Zogg M, Maifeld M, Decrease in anogenital distance among male infants with prenatal phthalate exposure, Environmental Health Perspectives. (2005). 10.1289/ehp.8100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Radke EG, Braun JM, Meeker JD, Cooper GS, Phthalate exposure and male reproductive outcomes: A systematic review of the human epidemiological evidence, Environment International. 121 (2018) 764–793. 10.1016/j.envint.2018.07.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Kreisman MJ, Song CI, Yip K, Natale BV, Natale DR, Breen KM, Androgens mediate sex-dependent gonadotropin expression during late prenatal development in the mouse, Endocrinology. 158 (2017) 2884–2894. 10.1210/en.2017-00285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Lovekamp-Swan T, Davis BJ, Mechanisms of phthalate ester toxicity in the female reproductive system, Environmental Health Perspectives. (2003). 10.1289/ehp.5658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Hannon PR, Niermann S, Flaws JA, Acute Exposure to Di(2-Ethylhexyl) Phthalate in Adulthood Causes Adverse Reproductive Outcomes Later in Life and Accelerates Reproductive Aging in Female Mice, Toxicological Sciences. (2016). 10.1093/toxsci/kfv317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Prados J, Stenz L, Somm E, Stouder C, Dayer A, Paoloni-Giacobino A, Prenatal exposure to DEHP affects spermatogenesis and sperm DNA methylation in a strain-dependent manner, PLoS ONE. (2015). 10.1371/journal.pone.0132136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Barakat R, Lin PCP, Rattan S, Brehm E, Canisso IF, Abosalum ME, Flaws JA, Hess R, Ko CM, Prenatal exposure to DEHP induces premature reproductive senescence in male mice, Toxicological Sciences. 156 (2017) 96–108. 10.1093/toxsci/kfw248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Brehm E, Rattan S, Gao L, Flaws JA, Prenatal exposure to Di(2-ethylhexyl) phthalate causes long-term transgenerational effects on female reproduction in mice, Endocrinology. (2018). 10.1210/en.2017-03004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Niermann S, Rattan S, Brehm E, Flaws JA, Prenatal exposure to di-(2-ethylhexyl) phthalate (DEHP) affects reproductive outcomes in female mice, Reproductive Toxicology. (2015). 10.1016/j.reprotox.2015.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Kaprara A, Huhtaniemi IT, The hypothalamus-pituitary-gonad axis: Tales of mice and men, Metabolism: Clinical and Experimental. 86 (2018) 3–17. 10.1016/j.metabol.2017.11.018. [DOI] [PubMed] [Google Scholar]
  • [17].Pocar P, Fiandanese N, Secchi C, Berrini A, Fischer B, Schmidt JS, Schaedlich K, Borromeo V, Exposure to di(2-ethyl-hexyl) phthalate (DEHP) in Utero and during lactation causes long-term pituitary-gonadal axis disruption in male and female mouse offspring, Endocrinology. 153 (2012) 937–948. 10.1210/en.2011-1450. [DOI] [PubMed] [Google Scholar]
  • [18].Pérez PA, Toledo J, Sosa L. del V., Peinetti N, Torres AI, De Paul AL, Gutiérrez S, The phthalate DEHP modulates the estrogen receptors α and β increasing lactotroph cell population in female pituitary glands, Chemosphere. (2020). 10.1016/j.chemosphere.2020.127304. [DOI] [PubMed] [Google Scholar]
  • [19].Ernst J, Jann JC, Biemann R, Koch HM, Fischer B, Effects of the environmental contaminants DEHP and TCDD on estradiol synthesis and aryl hydrocarbon receptor and peroxisome proliferatoractivated receptor signalling in the human granulosa cell line KGN, Molecular Human Reproduction. (2014). 10.1093/molehr/gau045. [DOI] [PubMed] [Google Scholar]
  • [20].Formosa R, Vassallo J, The Complex Biology of the Aryl Hydrocarbon Receptor and Its Role in the Pituitary Gland, Hormones and Cancer. 8 (2017) 197–210. 10.1007/s12672-017-0300-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Petkov PI, Rowlands JC, Budinsky R, Zhao B, Denison MS, Mekenyan O, Mechanism-based common reactivity pattern (COREPA) modelling of aryl hydrocarbon receptor binding affinity, SAR and QSAR in Environmental Research. (2010). 10.1080/10629360903570933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Junaid M, Jia PP, Tang YM, Xiong WX, Huang HY, Strauss PR, Li WG, Pei DS, Mechanistic toxicity of DEHP at environmentally relevant concentrations (ERCs) and ecological risk assessment in the Three Gorges Reservoir Area, China, Environmental Pollution. 242 (2018) 1939–1949. 10.1016/j.envpol.2018.07.067. [DOI] [PubMed] [Google Scholar]
  • [23].Lovekamp-Swan T, Jetten AM, Davis BJ, Dual activation of PPARα and PPARγ by mono-(2-ethylhexyl) phthalate in rat ovarian granulosa cells, Molecular and Cellular Endocrinology. (2003). 10.1016/S0303-7207(02)00423-9. [DOI] [PubMed] [Google Scholar]
  • [24].Krüger T, Long M, Bonefeld-Jørgensen EC, Plastic components affect the activation of the aryl hydrocarbon and the androgen receptor, Toxicology. 246 (2008) 112–123. 10.1016/J.TOX.2007.12.028. [DOI] [PubMed] [Google Scholar]
  • [25].Tsai CF, Hsieh TH, Lee JN, Hsu CY, Wang YC, Lai FJ, Kuo KK, Wu HL, Tsai EM, Kuo PL, Benzyl butyl phthalate induces migration, invasion, and angiogenesis of Huh7 hepatocellular carcinoma cells through nongenomic AhR/G-protein signaling, BMC Cancer. (2014). 10.1186/1471-2407-14-556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Mutoh J, Taketoh J, Okamura K, Kagawa T, Ishida T, Ishii Y, Yamada H, Fetal Pituitary Gonadotropin as an Initial Target of Dioxin in Its Impairment of Cholesterol Transportation and Steroidogenesis in Rats, Endocrinology. 147 (2006) 927–936. 10.1210/en.2005-1125. [DOI] [PubMed] [Google Scholar]
  • [27].Moran TB, Brannick KE, Raetzman LT, Aryl-hydrocarbon receptor activity modulates prolactin Expression in the pituitary, Toxicology and Applied Pharmacology. (2012). 10.1016/j.taap.2012.08.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Cao J, Patisaul HB, Petersen SL, Aryl hydrocarbon receptor activation in lactotropes and gonadotropes interferes with estradiol-dependent and -independent preprolactin, glycoprotein alpha and luteinizing hormone beta gene expression, Molecular and Cellular Endocrinology. 333 (2011) 151–159. 10.1016/j.mce.2010.12.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Weisz J, Ward IL, Plasma testosterone and progesterone titers of pregnant rats, their male and female fetuses, and neonatal offspring, Endocrinology. (1980). 10.1210/endo-106-1-306. [DOI] [PubMed] [Google Scholar]
  • [30].Hannon PR, Brannick KE, Wang W, Flaws JA, Mono(2-ethylhexyl) phthalate accelerates early folliculogenesis and inhibits steroidogenesis in cultured mouse whole ovaries and antral follicles, Biology of Reproduction. 92 (2015). 10.1095/biolreprod.115.129148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Hannon PR, Brannick KE, Wang W, Gupta RK, Flaws JA, Di(2-ethylhexyl) phthalate inhibits antral follicle growth, induces atresia, and inhibits steroid hormone production in cultured mouse antral follicles, Toxicology and Applied Pharmacology. (2015). 10.1016/j.taap.2015.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Nantie LB, Himes AD, Getz DR, Raetzman LT, Notch signaling in postnatal pituitary expansion: Proliferation, progenitors, and cell specification, Molecular Endocrinology. (2014). 10.1210/me.2013-1425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Muñoz JJ, Anauate AC, Amaral AG, Ferreira FM, Watanabe EH, Meca R, Ormanji MS, Boim MA, Onuchic LF, Heilberg IP, Ppia is the most stable housekeeping gene for qRT-PCR normalization in kidneys of three Pkd1-deficient mouse models, Scientific Reports 2021 11:1. 11 (2021) 1–14. 10.1038/s41598-021-99366-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Goldberg LB, Aujla PK, Raetzman LT, Persistent expression of activated Notch inhibits corticotrope and melanotrope differentiation and results in dysfunction of the HPA axis, Developmental Biology. (2011). 10.1016/j.ydbio.2011.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Lew D, Brady H, Klausing K, Yaginuma K, Theill LE, Stauber C, Karin M, Mellon PL, GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice., Genes & Development. 7 (1993) 683–693. 10.1101/GAD.7.4.683. [DOI] [PubMed] [Google Scholar]
  • [36].Borch J, Metzdorff SB, Vinggaard AM, Brokken L, Dalgaard M, Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis, Toxicology. (2006). 10.1016/j.tox.2006.03.015. [DOI] [PubMed] [Google Scholar]
  • [37].Schwartz CL, Christiansen S, Vinggaard AM, Axelstad M, Hass U, Svingen T, Anogenital distance as a toxicological or clinical marker for fetal androgen action and risk for reproductive disorders, Archives of Toxicology. (2019). 10.1007/s00204-018-2350-5. [DOI] [PubMed] [Google Scholar]
  • [38].J B, SB M, AM V, L B, M D, Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis, Toxicology. 223 (2006) 144–155. 10.1016/J.TOX.2006.03.015. [DOI] [PubMed] [Google Scholar]
  • [39].Simard J, Luthy I, Guay J, Bélanger A, Labrie F, Characteristics of interaction of the antiandrogen flutamide with the androgen receptor in various target tissues, Molecular and Cellular Endocrinology. 44 (1986) 261–270. 10.1016/0303-7207(86)90132-2. [DOI] [PubMed] [Google Scholar]
  • [40].Thompson IR, Kaiser UB, GnRH pulse frequency-dependent differential regulation of LH and FSH gene expression, Molecular and Cellular Endocrinology. (2014). 10.1016/j.mce.2013.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Gregory SJ, Kaiser UB, Regulation of gonadotropins by inhibin and activin, Seminars in Reproductive Medicine. (2004). 10.1055/s-2004-831901. [DOI] [PubMed] [Google Scholar]
  • [42].Borch J, Ladefoged O, Hass U, Vinggaard AM, Steroidogenesis in fetal male rats is reduced by DEHP and DINP, but endocrine effects of DEHP are not modulated by DEHA in fetal, prepubertal and adult male rats, Reproductive Toxicology. (2004). 10.1016/j.reprotox.2003.10.011. [DOI] [PubMed] [Google Scholar]
  • [43].Tapella L, Sesta A, Cassarino MF, Zunino V, Catalano MG, Pecori Giraldi F, Benzene and 2-ethyl-phthalate induce proliferation in normal rat pituitary cells, Pituitary. (2017). 10.1007/s11102-016-0777-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Hattori Y, Takeda T, Nakamura A, Nishida K, Shioji Y, Fukumitsu H, Yamada H, Ishii Y, The aryl hydrocarbon receptor is indispensable for dioxin-induced defects in sexually-dimorphic behaviors due to the reduction in fetal steroidogenesis of the pituitary-gonadal axis in rats, Biochemical Pharmacology. 154 (2018)213–221. 10.1016/j.bcp.2018.05.008. [DOI] [PubMed] [Google Scholar]
  • [45].Ricci MS, Toscano DG, Mattingly CJ, Toscano WA, Estrogen receptor reduces CYP1A1 induction in cultured human endometrial cells, Journal of Biological Chemistry. (1999). 10.1074/jbc.274.6.3430. [DOI] [PubMed] [Google Scholar]
  • [46].Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR, Lee D-H, Shioda T, Soto AM, vom Saal FS, Welshons W. v., Zoeller RT, Myers JP, Hormones and Endocrine-Disrupting Chemicals: Low-Dose Effects and Nonmonotonic Dose Responses, Endocrine Reviews. 33 (2012) 378–455. 10.1210/ER.2011-1050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Do RP, Stahlhut RW, Ponzi D, vom Saal FS, Taylor JA, Non-monotonic dose effects of in utero exposure to di(2-ethylhexyl) phthalate (DEHP) on testicular and serum testosterone and anogenital distance in male mouse fetuses, Reproductive Toxicology. 34 (2012) 614–621. 10.1016/J.REPROTOX.2012.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Peraza MA, Burdick AD, Marin HE, Gonzalez FJ, Peters JM, The toxicology of ligands for peroxisome proliferator-activated receptors (PPAR), Toxicological Sciences. (2006). 10.1093/toxsci/kfj062. [DOI] [PubMed] [Google Scholar]
  • [49].Latini G, Scoditti E, Verrotti A, De Felice C, Massaro M, Peroxisome Proliferator-Activated Receptors as Mediators of Phthalate-Induced Effects in the Male and Female Reproductive Tract: Epidemiological and Experimental Evidence, PPAR Research. (2008). 10.1155/2008/359267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [50].Knig B, Rauer C, Rosenbaum S, Brandsch C, Eder K, Stangl GI, Fasting upregulates PPARα target genes in brain and influences pituitary hormone expression in a ppar dependent manner, PPAR Research. (2009). 10.1155/2009/801609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Heaney AP, Fernando M, Melmed S, PPAR-γ receptor ligands: novel therapy for pituitary adenomas, Journal of Clinical Investigation. (2003). 10.1172/jci16575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Bogazzi F, Russo D, Locci MT, Chifenti B, Ultimieri F, Raggi F, Viacava P, Cecchetti D, Cosci C, Sardella C, Acerbi G, Gasperi M, Martino E, Peroxisome proliferator-activated receptor (PPAR)γ is highly expressed in normal human pituitary gland, Journal of Endocrinological Investigation. (2005). 10.1007/bf03345321. [DOI] [PubMed] [Google Scholar]
  • [53].Sérée E, Villard PH, Pascussi JM, Pineau T, Maurel P, Nguyen QB, Fallone F, Martin PM, Champion S, Lacarelle B, Savouret JF, Barra Y, Evidence for a new human CYP1A1 regulation pathway involving PPAR-α and 2 PPRE sites, Gastroenterology. (2004). 10.1053/j.gastro.2004.08.023. [DOI] [PubMed] [Google Scholar]
  • [54].Zhao B, DeGroot DE, Hayashi A, He G, Denison MS, Ch223191 is a ligand-selective antagonist of the Ah (dioxin) receptor, Toxicological Sciences. (2010). 10.1093/toxsci/kfq217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Takeda M, Otsuka F, Otani H, Inagaki K, Miyoshi T, Suzuki J, Mimura Y, Ogura T, Makino H, Effects of peroxisome proliferator-activated receptor activation on gonadotropin transcription and cell mitosis induced by bone morphogenetic proteins in mouse gonadotrope LβT2 cells, Journal of Endocrinology. (2007). 10.1677/JOE-07-0138. [DOI] [PubMed] [Google Scholar]
  • [56].Koike E, ichiro Inoue K, Yanagisawa R, Takano H, Di-(2-ethylhexyl) phthalate affects immune cells from atopic prone mice in vitro, Toxicology. (2009). 10.1016/j.tox.2009.02.002. [DOI] [PubMed] [Google Scholar]
  • [57].Kitaoka M, Hirai S, Terayama H, Naito M, Qu N, Hatayama N, Miyaso H, Matsuno Y, Komiyama M, Itoh M, Mori C, Effects on the local immunity in the testis by exposure to di-(2-ethylhexyl) phthalate (DEHP) in mice, Journal of Reproduction and Development. (2013). 10.1262/jrd.2012-180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [58].Kasahara E, Sato EF, Miyoshi M, Konaka R, Hiramoto K, Sasaki J, Tokuda M, Nakano Y, Inoue M, Role of oxidative stress in germ cell apoptosis induced by di(2-ethylhexyl)phthalate, Biochemical Journal. (2002). 10.1042/BJ20020254. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES