TABLE 1.
Primer sequences used to quantify RNA expression of genes of interest and reference genes by RT-qPCR.
| Type of gene | Target | Primer sequence 5’ 3’ | Amplicon length (bp) | E (%) | R 2 |
| Target genes | Kakusei | CTACAACGTCCTCTTCGATT (forward) CCTACCTTGGTATTGCAGTT (reverse) | 149 | 96.4 | 0.991 |
| Hr38 | TGAGATCACCTGGTTGAAAG (forward) CGTAGCAGGATCAATTTCCA (reverse) | 118 | 106 | 0.995 | |
| Egr1 | GAGAAACCGTTCTGCTGTGA (forward) GCTCTGAGGGTGATTTCTCG (reverse) | 138 | 109 | 0.991 | |
| Reference genes | Ef1a | AAGAGCATCAAGAGCGGAGA (forward) CACTC TTAATGACGCCCACA (reverse) | 148 | 106 | 0.993 |
| Actin | TGCCAACACTGTCCTTTCTG (forward) AGAATTGACCCACCAATCCA (reverse) | 156 | 110 | 0.995 |
bp, amplicon length; E (%), efficiency; R2, coefficient of correlation obtained for the standard curve; Hr38, hormone receptor 38 gene; Egr1, early growth response gene-1; Ef1α, elongation factor 1 α gene.