REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Mouse monoclonal αSMA antibody | Sigma | Cat# a5228; RRID:AB_262054 |
Rabbit polyclonal Axin2 antibody | Abcam | Cat# ab32197; RRID:AB_2290204 |
Rabbit polyclonal β-catenin antibody | Sigma | Cat# SAB4500541; RRID:AB_10743932 |
Rabbit monoclonal E-cadherin antibody | Cell Signaling | Cat# 3195; RRID:AB_2291471 |
Rat monoclonal E-cadherin antibody | Invitrogen | Cat # 13-1900; RRID:AB_86571 |
Rabbit polyclonal Foxp1 antibody | Cell Signaling | Cat# 2005; RRID:AB_2106979 |
Rabbit polyclonal GFP antibody | Invitrogen | Cat# A-11122; RRID:AB_221569 |
Rabbit monoclonal Lef1 antibody | Cell Signaling | Cat# 2230; RRID:AB_823558 |
Rabbit polyclonal CD31 (PECAM) antibody | Abcam | Cat# ab28364; RRID:AB_726362 |
Rabbit polyclonal Pitx2 antibody | L’Honoré et al., 2007, gift of Jacques Drouin | N/A |
Rabbit polyclonal RFP antibody | Abcam | Cat# ab62341; RRID:AB_945213 |
Rabbit polyclonal Tbx3 antibody | Invitrogen | Cat# 42-4800; RRID:AB_2533526 |
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Invitrogen | Cat# A-21240; RRID:AB_141658 |
Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A-11006; RRID:AB_141373 |
Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A-11007; RRID:AB_141374 |
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat# A-11012; RRID:AB_141359 |
Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Invitrogen | Cat# A-21244; RRID:AB_2535812 |
Alexa Fluor 568 Phalloidin | Thermo Fisher Scientific | Cat# A12380 |
Alexa Fluor 488 Phalloidin | Thermo Fisher Scientific | Cat# A12379 |
Chemicals, peptides, and recombinant proteins | ||
LiCl | Sigma | L9650 |
IWR1 | Sigma | I0161 |
Cyclopamine | Tocris | 1623 |
Critical commercial assays | ||
RNAScope Multiplex Fluorescent V2 Assay | ACD | Cat No. 323100 |
RNAScope Probe Mm-Hoxb6 | ACD | Cat No. 564171 |
RNAScope Probe Mm-Ptn-C3 | ACD | Cat No. 486381-C3 |
Deposited data | ||
Raw and analyzed scRNA-seq data of E11.5 lungs | This paper | GEO: GSE153069 |
Raw and analyzed bulk RNA-seq data of E13.5 Myocd mutant lungs | Young et al., 2020 | GEO: GSE143394 |
ENCODE E14 lung DNase-hypersensitivity dataset | Yue et al., 2014 | http://www.mouseencode.org/ |
Experimental models: Organisms/strains | ||
Mouse: CD1 | ||
Mouse: B6.129-Ctnnb1tm2Kem/KnwJ | The Jackson Laboratory | JAX: 004152 |
Mouse: B6.129X1-Twist2tm1.1(cre)Dor/J | The Jackson Laboratory | JAX: 008712 |
Mouse: B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/J | The Jackson Laboratory | JAX: 017492 |
Mouse: B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J | The Jackson Laboratory | JAX: 007676 |
Mouse: B6.FVB-Tg(Acta2-DsRed)1Rkl/J | The Jackson Laboratory | JAX: 031159 |
Mouse: Tbx4-rtTA | Gift from Wei Shi | N/A |
Mouse: tet-O-Cre | The Jackson Laboratory | JAX: 006234 |
Mouse: VinTS | Laboratory of Sevan Hopyan, Tao et al., 2019 | N/A |
Mouse: Yap1tm1.1Dupa/J | The Jackson Laboratory | JAX: 027929 |
Oligonucleotides | ||
Primer: Cre, Forward: GCATTACCGGTCGATGCAACGAGTGATGAG | Devenport Lab | N/A |
Primer: Cre, Reverse: GAGTGAACGAACCTGGTCGAAATCAGTGCG | Devenport Lab | N/A |
Primer: Tbx4, Forward: CGGCCCCGAATTCACCATGTCTAGA | Zhang et al., 2013 | N/A |
Primer: Tbx4, Reverse: ACGCGTCGACACTTAGTTACCCGGGGAGCATG | Zhang et al., 2013 | N/A |
Primer: Ctnnb1-flox, Forward: AAGGTAGAGTGATGAAAGTTGTT | The Jackson Laboratory | Primer no. oIMR1512 |
Primer: Ctnnb1-flox, Reverse: CACCATGTCCTCTGTCTATTC | The Jackson Laboratory | Primer no. oIMR1513 |
Primer: Yap1-flox, Forward: AGGACAGCCAGGACTACACAG | The Jackson Laboratory | Primer no. 29878 |
Primer: Yap1-flox, Reverse: CACCAGCCTTTAAATTGAGAAC | The Jackson Laboratory | Primer no. 29879 |
Primer: mTmG, Wildtype Forward: AGGGAGCTGCAGTGGAGTAG | The Jackson Laboratory | Primer no. 30298 |
Primer: mTmG, Mutant Forward: TAGAGCTTGCGGAACCCTTC | The Jackson Laboratory | Primer no. 30297 |
Primer: mTmG, Common Reverse: CTTTAAGCCTGCCCAGAAGA | The Jackson Laboratory |
Primer no. 12177 |
Software and algorithms | ||
ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
MATLAB | MathWorks | N/A |
CellRanger | 10× Genomics | Version 2.0.1 |
R | R Foundation for Statistical Computing | N/A |
Python | N/A | N/A |
HOMER | Heinz et al., 2010 | http://homer.ucsd.edu/homer/ |
Regulatory Sequence Analysis Tools | Nguyen et al., 2018 | http://rsat.sb-roscoff.fr/ |
DESeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
Seurat | Butler et al., 2018 | https://satijalab.org/seurat/ |
Destiny | Haghverdi et al., 2015 | https://www.bioconductor.org/packages/release/bioc/html/destiny.html |
Edge | Storey et al., 2019 | https://www.bioconductor.org/packages/release/bioc/html/edge.html |
clusterProfiler | Yu et al., 2012 | https://www.bioconductor.org/packages//2.10/bioc/html/clusterProfiler.html |
Other | ||
Opal 520 Reagent Pack | Akoya Biosciences | FP1487001KT |
Opal 620 Reagent Pack | Akoya Biosciences | FP1495001KT |