Skip to main content
. 2022 Feb 22;11:e71880. doi: 10.7554/eLife.71880

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Cell line (Homo sapiens) Hep3B ATCC Cat#: HB-8064;RRID:CVCL_0326
Cell line (H. sapiens) HepG2 ATCC Cat#: HB-8065; RRID:CVCL_0027
Cell line (H. sapiens) Huh6 RCB Cat#: RCB1367; RRID:CVCL_4381
Cell line (H. sapiens) Huh7 JCRB Cat#: JCRB0403; RRID:CVCL_0336
Cell line (H. sapiens) MHCC97H Zhongshan Hospital RRID:CVCL_4972 Liver Cancer Institute of Zhongshan Hospital (Shanghai, China)
Cell line (H. sapiens) PLC/PRF/5 ATCC Cat#: CRL-802;RRID:CVCL_0485
Cell line (H. sapiens) SNU398 ATCC Cat#: CRL-2233; RRID:CVCL_0077
Cell line (H. sapiens) SNU449 ATCC Cat#: CRL-2234; RRID:CVCL_0454
Cell line (H. sapiens) SNU475 ATCC Cat#: CRL-2236;RRID:CVCL_0497
Cell line (H. sapiens) SK-Hep1 ATCC Cat#: HTB-52; RRID:CVCL_0525
Cell line (H. sapiens) LX2 ATCC Cat#: SCC064;RRID:CVCL_5792
Chemical compound, drug Homoharringtonine Selleck Chemicals S9015
Antibody Anti-HSP90 (Mouse monoclonal) Santa Cruz Biotechnology Cat#: sc-13119;RRID:AB_675659 WB (1:5000)
Antibody Anti-α-SMA (Mouse monoclonal) Sigma-Aldrich Cat#: A5228; RRID:AB_262054 WB (1:2000)IF (1:200)
Antibody Anti-Collagen I (Rabbit polyclonal) ProteinTech Cat#: 14695-1-AP; RRID:AB_2082037 WB (1:2000)IF (1:200)
Sequence-based reagent ACTA2_F This paper PCR primer 5′GACAATGGCTCTGGGCTCTGTAA3′
Sequence-based reagent ACTA2_R This paper PCR primer 5′CTGTGCTTCGTCACCCACGTA3′
Sequence-based reagent COL1A1_F This paper PCR primer 5′TCCTGGTCCTGCTGGCAAAGAA3′
Sequence-based reagent COL1A1_R This paper PCR primer 5′CACGCTGTCCAGCAATACCTTGA3′
Software, algorithm R software, version 3.6.0 https://cran.r-project.org/ RRID:SCR_001905
Software, algorithm ImageJ, version 1.53k http://imagej.net/ RRID:SCR_003070
Software, algorithm Combenefit, version 2.02 https://sourceforge.net/projects/combenefit/