KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
|
| ||
| anti-CD4 (GK1.5) | Alejandro Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA) and (Noelle et al., 1992) | N/A |
| anti-CD4 (RM4-5) APC-eF780 | eBioscience | Cat#47-0042-82 |
| anti-CD4 (RM4-5) PerCP-Cy5.5 | Tonbo Biosciences | Cat#65-0042-U 100 |
| anti-CD8 (53-6.7) eF450 | eBioscience | Cat#48-0081-82 |
| anti-CD8 (53-6.7) PE | Tonbo Biosciences | Cat#50-0081-U 100 |
| anti-CD11b (M1/70) PE-Cy7 | 3D Biosciences | Cat#552850 |
| anti-CD11c (N418) PerCP-Cy5.5 | eBioscience | Cat#45-0114-82 |
| anti-CD25 (PC61.5) PerCP-C5.5 | Tonbo Biosciences | Cat#65-0251-U 100 |
| anti-CD40L (MR1) | Alejandro Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA) and (Noelle et al., 1992) | N/A |
| ant-CD44 (IM7) PerCP-Cy5.5 | eBioscience | Cat#45-0441-82 |
| ant-CD45.1 (A20) APC-eF780 | eBioscience | Cat#47-0453-82 |
| ant-CD45.2 (104) APC | Tonbo Biosciences | Cat#20-0454-U 100 |
| ant-CD45R/B220 (RA3-6B2) APC-eF780 | eBioscience | Cat#47-0452-82 |
| ant-CD45R/B220 (RA3-6B2) BV605 | BD Biosciences | Cat#563708 |
| ant-CD69 (H1.2F3) APC | BioLegend | Cat#104513 |
| ant-CD103 (2E7) APC | eBioscience | Cat#17-1031-80 |
| ant-CD103 (2E7) PE | eBioscience | Cat#12-1031-82 |
| ant-F4/80 (BM8) PE | eBioscience | Cat#12-4801-80 |
| ant-FoxP3 (FJK-16 s) PE | eBioscience | Cat#12-5773-82 |
| ant-GFP (pAb) FITC | Rockland Immunochemicals | Cat#600-402-215 |
| ant-IFN-β (RMMB-1) FITC | PBL Assay Science | Cat#22400-3 |
| ant-IFN-γ (XMG1.2) APC | eBioscience | Cat#17-7311-82 |
| ant-IL-2 (JES6-5H4) PE | BioLegend | Cat#503808 |
| ant-IL-4 (11B11) | BioLegend | Cat#504108 |
| ant-IL-12 (p40) (C17.8) PE | Tonbo Biosciences | Cat#50-7123-U100 |
| ant-IL-12 (p70) (R2-9A5) | BioXCell | Cat#BE0233 |
| ant-Ki-67 (SolA15) eF450 | eBioscience | Cat#48-5698-82 |
| ant-Ly6G (1A8) | BioXCell | Cat#BP0075 |
| ant-MHC II (M5/114.15.2) APC-eF780 | eBioscience | Cat#47-5321-80 |
| ant-MHC II (M5/114.15.2) eF450 | eBioscience | Cat#48-5321-80 |
| ant-NK1.1 (PK136) APC | eBioscience | Cat#17-5941-82 |
| ant-NK1.1 (PK136) PE-Cy7 | eBioscience | Cat#25-5941-82 |
| ant-TCRβ (H57-597) APC | Tonbo Biosciences | Cat#20-5961-U 100 |
| ant-TCRβ (H57-597) FITC | Tonbo Biosciences | Cat#35-5961-U 100 |
| ant-TCRβ (H57-597) Pacific Blue | BioLegend | Cat#109226 |
| ant-TCRβ (H57-597) PE | Tonbo Biosciences | Cat#50-5961-U025 |
| ant-TCRβ (H57-597) PE-Cy7 | Tonbo Biosciences | Cat#60-5961-U 100 |
| ant-TLR9 (26C593.2) AF647 | Thermo Scientific and self-labeled | Cat#MA5-16178 |
| ant-TNF-α (MP6-XT22) PE-Cy7 | BD Biosciences | Cat#557644 |
|
| ||
| Bacterial and Virus Strains | ||
|
| ||
| WT Listeria monocytogenes (Lm) 10403S | Daniel A. Portnoy (University of California, Berkeley, CA) | N/A |
| WT Lm Ova | Daniel A. Portnoy (University of California, Berkeley, CA) | N/A |
| Lm ΔactA 10403S | Daniel A. Portnoy (University of California, Berkeley, CA) | N/A |
| Lm ΔactA-Ova 10403S | Daniel A. Portnoy (University of California, Berkeley, CA) | N/A |
|
| ||
| Chemicals, Peptides, and Recombinant Proteins | ||
|
| ||
| CellTrace Violet (CTV) | Life Technologies | Cat#C34557 |
| 4’,6-diamidino-2-phenylindole (DAPI) | Molecular Probes | Cat#D1306 |
| diphtheria toxin (DT) | Sigma-Aldrich | Cat#D0564 |
| DNase I, from bovine pancreas | Sigma-Aldrich | Cat#11284932001 |
| H-2Kb-Ova iTAg tetramer PE | MBL International | Cat#TB-5001-1 |
| Mouse T-Activator anti-CD3/CD28 Dynabeads | GIBCO | Cat#11452D |
| Ova257–264 peptide (SIINFEKL) | AnaSpec | Cat#AS-60193-1 |
| rmIL-12 (p70) | R&D Systems | Cat#419-ML-010 |
| rmTGF-β1 | R&D Systems | Cat#7666-MB-005 |
|
| ||
| Critical Commercial Assays | ||
|
| ||
| human/mouse TGF-β1 ELISA | Invitrogen | Cat#88-8350-86 |
| liquid ALT (SGPT) Reagent set | Pointe Scientific | Cat#A7526150 |
| live/Dead Fixable Yellow Dead Cell Stain kit | Invitrogen | Cat#L-34968 |
| MILLIPLEX MAP 32-plex mouse cytokine/chemokine panel | EMD Millipore | Cat#MCYTMAG-7 0K-PX32 |
| mouse IFN-α2/4 Platinum ELISA | eBioscience | Cat#BMS6027 |
| mouse IFN-β VeriKine ELISA | PBL Assay Science | Cat#42400 |
| Novagen NovaQUANT Mouse Mitochondrial to Nuclear Ratio kit | EMD Millipore | Cat#72621 −1KIT |
|
| ||
| Deposited Data | ||
|
| ||
| RNA-Seq metadata | NCBI gene expression omnibus | GSE106554 |
|
| ||
| Experimental Models: Mice | ||
|
| ||
| C57BL/6 | The Jackson Laboratory | Stock#000664 |
| Act-mOva H-2kb−/− | Marc K. Jenkins (University of Minnesota, Minneapolis, MN) and (Feau et al., 2011; Janssen et al., 2005) | N/A |
| Batf3−/− | The Jackson Laboratory | Stock#013755 |
| Foxp3EGFP (FoxP3-EGFP) | The Jackson Laboratory | Stock#006772 |
| Foxp3 DTR-EGFP | The Jackson Laboratory | Stock#016958 |
| Il12rb2 −/− | The Jackson Laboratory | Stock#003248 |
| Nr4a1GFP (Nur77-GFP) | Kristin A. Hogquist (University of Minnesota) and (Moran et al., 2011) | N/A |
| p65-GFP | Manolis Pasparakis (University of Cologne, Cologne, Germany) and (De Lorenzi et al., 2009) | N/A |
| Tlr2 −/− | The Jackson Laboratory | Stock#004650 |
| Tlr4 −/− | The Jackson Laboratory | Stock#007227 |
| Tlr7 −/− | The Jackson Laboratory | Stock#008380 |
| Tlr9 M7Btlr | The Jackson Laboratory | Stock#014534 |
|
| ||
| Oligonucleotides | ||
|
| ||
| Mus musculus Tlr2 QuantiTect primers | QIAGEN | Cat#QT00129752 |
| Mus musculus Tlr4 QuantiTect primers | QIAGEN | Cat#QT00259042 |
| Mus musculus Tlr7 QuantiTect primers | QIAGEN | Cat#QT00251013 |
| Mus musculus Tlr9 QuantiTect primers | QIAGEN | Cat#QT01043049 |
| forward primer for Lm mpl CCAGTATTCGGCGGGATTGG | self-designed | N/A |
| reverse primer for Lm mpl GACCCACGCACACAGACATC | self-designed | N/A |
| forward primer for Lm plcB GCAACGGAAGACATGGTAGCAA | self-designed | N/A |
| reverse primer for Lm plcB GTAGTCCGCTTTCGCCCTTT | self-designed | N/A |
| forward primer for Mus musculus Hprtl CTCCGCCGGCTTCCTCCTCA | self-designed | N/A |
| reverse primer for Mus musculus Hprtl ACCTGGTTCATCATCGCTAATC | self-designed | N/A |
| forward primer for ovalbumin GTCAGCAGAGGCTGGAGTGGA | self-designed | N/A |
| reverse primer for ovalbumin GGCGTTGGTTGCGATGTGCT | self-designed | N/A |
| ODN 1585 Ctrl (CpG-A Ctrl) ggGGTCAAGCTTGAgggggg | InvivoGen | Cat#tlrl-1585c |
| ODN 1585 (CpG-A) ggGGTCAACGTTGAgggggg | InvivoGen | Cat#tlrl-1585 |
| ODN 1668 Ctrl (CpG-B Ctrl) tccatgagcttcctgatgct | InvivoGen | Cat#tlrl-1668c |
| ODN 1668 (CpG-B) tccatgacgttcctgatgct | InvivoGen | Cat#tlrl-1668 |
|
| ||
| Software and Algorithms | ||
|
| ||
| Bioconductor (v3.0) package DESeq2 (v1.6.3) | Love et al., 2014 | N/A |
| FlowJo (v9.7.5 and v10.4.2) software | Tree Star Inc. | N/A |
| IDEAS (v6.2.183.0) software | Amnis Inc. | N/A |
| Ingenuity Pathway Analysis (IPA; v01-07) software | QIAGEN | N/A |
| Luminex MAGPIX System with xPONENT (v4.2) software | Luminex | N/A |
| Python HTSeq (v0.6.0) software | Anders et al., 2015 | N/A |
| PRINSEQ Lite (v0.20.3) software | Schmieder and Edwards, 2011 | N/A |
| Prism (v7.0a and v8.0.2) software | GraphPad Software Inc. | N/A |
| SAMtools | Li et al., 2009 | N/A |
| SoftMax Pro (v5.3b12) software | Molecular Devices | N/A |
| TopHat (v1.4.1) software | Trapnell et al., 2009 | N/A |
|
| ||
| Other | ||
|
| ||
| Cytofix/Cytoperm | BD Biosciences | Cat#554722 |
| FoxP3 Staining set | eBioscience | Cat#00-5523-00 |
| GolgiPlug | BD Biosciences | Cat#555029 |
| GolgiStop | BD Biosciences | Cat#554724 |
| ionomycin | Sigma-Aldrich | Cat#P1585 |
| phorbol 12-myristate 13-acetate (PMA) | Sigma-Aldrich | Cat#I0634 |