KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| LEAF™ Purified anti-mouse CD16/32 antibody | BioLegend | Cat# 101321, RRID:AB_1877064 |
| PE Rat Anti-Mouse CD8a | Thermo Fisher Scientific | Clone 53-6.7; Cat# 12-0081-83; RRID:AB_465531 |
| BV421 Rat Anti-Mouse CD8a | BD Biosciences | Clone 53-6.7; Cat# 563898; RRID:AB_2738474 |
| BV510 Rat Anti-Mouse CD4 | BD Biosciences | Clone RM4-5; Cat# 563106; RRID:AB_2687550 |
| PE-Cy™7 Rat Anti-Mouse CD4 | BD Biosciences | Clone RM4-5; Cat# 552775; RRID:AB_394461 |
| APC Rat Anti-Mouse IFN-γ | BD Biosciences | Clone XMG1.2; Cat# 554413; RRID:AB_398551 |
| Alexa Fluor® 700 Rat anti-Mouse TNF | BD Biosciences | Clone MP6-XT22; Cat # 558000; RRID:AB_396980 |
| PE Rat anti-mouse Granzyme B Monoclonal Antibody, eBioscience™ | Thermo Fisher Scientific | Clone NGZB; Cat # 12-8898-82; RRID:AB_10870787 |
| BV421 Hamster Anti-Mouse CD3e | BD Biosciences | Clone 145-2C11; Cat # 562600; RRID:AB_11153670 |
| PE-Cy™7 Rat Anti-Mouse CD19 | BD Biosciences | Clone 1D3; Cat # 552854; RRID:AB_394495 |
| PE Hamster Anti-Mouse CD11c | BD Biosciences | Clone HL3; Cat # 557401; RRID:AB_396684 |
| PE-CF594 Rat Anti-CD11b | BD Biosciences | Clone M1/70; Cat # 562287; RRID:AB_11154216 |
| PerCP-Cy5.5 mouse anti-mouse H-2Kb Antibody | Biolegend | Clone AF6-88.5; Cat # 116516; RRID:AB_1967133 |
| Alexa Fluor® 700 Rat Anti-Mouse CD4 | BD Biosciences | Clone RM4-5; Cat # 557956; RRID:AB_396956 |
| Brilliant Violet 510™ Rat anti-mouse Ly-6G | BioLegend | clone 1A8; Cat # 127633; RRID:AB_2562937 |
| PerCP-Cy™5.5 Rat Anti-Mouse CD45 | BD Biosciences | Clone 30-F11; Cat # 550994; RRID:AB_394003 |
| PE Mouse Anti-Mouse NK-1.1 | BD Biosciences | Clone PK136; Cat# 557391; RRID:AB_396674 |
| Alexa Fluor® 700 rat anti-mouse CCR2 | R & D Systems | Clone # 475301; Cat # FAB5538N; RRID:AB_2725739 |
| APC Rat anti-Mouse CD86 | BD Biosciences | clone GL1; Cat # 558703; RRID:AB_2075114 |
| Brilliant Violet 711™ Rat anti-mouse Ly-6C | BioLegend | clone HK1.4; Cat # 128037; RRID:AB_2562630 |
| PE Rat Anti-CD11b | BD Biosciences | Clone M1/70; Cat # 553311; RRID: AB_394775 |
| Alexa Fluor 700 rat anti-mouse CD86 | BD Biosciences | Clone GL1; Cat # 560581; RRID:AB_1727517 |
| FITC Rat Anti-Mouse I-A/I-E | BD Biosciences | Clone 2G9; Cat # 553623; RRID:AB_394958 |
| FITC Hamster anti-mouse CD3 | BD Biosciences | Clone 145-2C11; Cat # 553062; RRID:AB_394595 |
| Monoclonal Anti-MAP2 (2a+2b) antibody produced in mouse | Sigma-Aldrich | clone AP-20; Cat # M1406; RRID:AB_477171 |
| Anti-Glial Fibrillary Acidic Protein (GFAP) antibody | Millipore | Cat # AB5804; RRID:AB_2109645 |
| Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat # A-11001; RRID:AB_2534069 |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Invitrogen | Cat # A-21244; RRID:AB_2535812 |
| Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat # A-11032; RRID:AB_2534091 |
| F(ab’)2-Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat # A-11070; RRID:AB_2534114 |
| Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 555 | Invitrogen | Cat # A21429; RRID:AB_2535850 |
| Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Invitrogen | Cat # A-21235; RRID: AB_2535804 |
| Anti-Rabbit IgG (H+L), HRP Conjugate antibody | Promega | Cat # W4011; RRID:AB_430833 |
| Anti-Mouse IgG (H+L) Antibody, HRP Conjugated | Promega | Cat # W4021; RRID:AB_430834 |
| Rabbit anti-HPGSVNEFDF | (Buaillon et al., 2017) | N/A |
| Rabbit anti-SIINFEKL | Biotem, this study | N/A |
| Mouse anti-GRA 1 | Biotem; M.-F. Cesbron-Delauw | clone TG17.43 |
| Mouse anti-GRA2 | Biotem; M.-F. Cesbron-Delauw | clone Tg17-179 |
| H2-Kb-SIINFEKL Dextramer PE | Immudex | Cat # JD2163 |
| Rabbit anti-TgProfilin | D. Soldati-Favre | PRF556 |
| Rabbit anti-chicken OVA | Sigma | Cat # C6534; RRID: AB_258953 |
| Rabbit anti-Iba1 | Wako | Cat # 019-19741; RRID: AB_839504 |
| Rabbit anti-MAP2 | Millipore | Cat# AB5622; RRID: AB_91939 |
| anti-H-2Ld AF647 | Biotem, (Ozato et al., 1980) | clone 30-5-7 |
| Bacterial and Virus Strains | ||
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| HPGSVNEFDF (HF10) | Genecust | N/A |
| SIINFEKL | Genecust | N/A |
| SVLAFRRL | Genecust | N/A |
| Mouse IFN-γ premium grade | Miltenyi Biotec | Cat # 130-105-774 |
| Mycophenolic acid | Sigma-Aldrich | Cat # M5255 |
| Xanthine | Sigma-Aldrich | Cat # X-2502 |
| DNAse I from bovine pancreas | Sigma-Aldrich | Cat # DN25 |
| Collagenase D from Clostridium Histolyticum | Roche | Cat # 11088882001 |
| Rhodamine labeled Dolichos Biflorus Agglutinin (DBA) | Vector Laboratories | Cat # RL-1032; RRID: AB_2336396 |
| eBioscience™ Fixable Viability Dye eFIuor™ 450 | Invitrogen | Cat # 65-0863-14 |
| eBioscience™ Fixable Viability Dye eFIuor™ 660 | Invitrogen | Cat # 65-0864-14 |
| LIVE/DEAD™ Fixable Green Dead Cell Stain Kit, for 488 nm excitation | Invitrogen | Cat # L34970 |
| Triton X-100 | Sigma-Aldrich | Cat # X100 |
| Tween®20 | Sigma-Aldrich | Cat # P1379 |
| ProLong Diamond Anti-Fade Mounting medium with DAPI | Invitrogen | Cat # P36962 |
| Paraformaldehyde 20 % aqueous solution | Electron Microscopy Sciences | Cat # 15713 |
| Apicidin | Sigma-Aldrich | Cat # A8851 |
| Laemmli Sample Buffer | BIO-RAD | Cat # 1610737 |
| Percoll | GE Healthcare | Cat # 17-0891-01 |
| eBioscience Brefeldin A solution | Thermo Fisher Scientific | Cat # 00-4506-51 |
| eBioscience Permeabilization Buffer (10X) | Thermo Fisher Scientific | Cat # 00-8333-56 |
| Poly-D-lysine | Merck Millipore | Cat # A-003-E |
| UltraPure™ DNase/RNase-Free Distilled Water | Invitrogen | Cat # 10977035 |
| Laminin Mouse Protein, Natural | Invitrogen | Cat # 23017-015 |
| Papain | Worthington Biochemical Corporation | Cat # LK003176 |
| Bovine Serum Albumin | Dutscher | Cat # SH30574.02 |
| Trypsin Inhibitor from chicken egg white | Roche | Cat # 10109878001 |
| B-27 supplement | Gibco | Cat # 17504044 |
| GlutaMAX Supplement | Gibco | Cat # 35050061 |
| Cytarabine Hydrochloride | Sigma-Aldrich | Cat # C6645 |
| Normal Goat Serum | Vector Laboratories | Cat # S-1000 |
| chlorophenol red-β-D-galactopyranoside CPRG | Roche | Cat # 10884308001 |
| Glutaraldehyde 8% aqueous solution | Electron Microscopy Science | Cat # 16019 |
| X-gal | Sigma-Aldrich | Cat # B4252 |
| Potassium Ferrocyanide | Sigma-Aldrich | Cat # 60279 |
| Potassium Ferricyanide | Sigma-Aldrich | Cat # 60299 |
| Magnesium Chloride Hexahydrate | Sigma-Aldrich | Cat # M2670 |
| Tetrodotoxin | Sigma-Aldrich | Cat # T8024 |
| TBS | Euromedex | Cat # ET220 |
| DAPI | Sigma-Aldrich | Cat # D9542 |
| Fluoromount medium | Electron Microscopy Sciences | Cat # 17984-25 |
| Critical Commercial Assays | ||
| DNEasy Blood and Tissue Kit | Qiagen | Cat # 69504 |
| Deposited Data | ||
| Experimental Models: Cell Lines | ||
| MutuDC | (Fuertes Marraco et al., 2012), H. Acha-Orbea | N/A |
| Human Foreskin Fibroblasts (HFF) | ATCC | Cat# SCRC-1041 |
| SIINFEKL-specific LacZ-inducible CD8 T cell reporter hybridomas (B3Z) | (Karttunen et al., 1992), N. Shastri | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: CBA: CBA/JRj | Janvier | N/A |
| Mouse: B6 or C57BL/6: C57BL/6J | Janvier | N/A |
| Mouse: B6.H-2d: B6.C-H2d/bByJ | Jax | Cat # 000359 |
| Mouse: B6.CamKIIα-iCre | (Casanova et al., 2001), G. Schutz | N/A |
| Mouse: B6.LdLox: | This study | N/A |
| T. gondii: 76K | (Bonnart et al., 2017); D. Buzoni-Gatel | N/A |
| T. gondii: Tg.Tomato: Pru.Δhxgprt.tdTOMATOprom TUB | (Schaeffer et al., 2009) | N/A |
| T. gondii: Tg.pTUB/vacOVA: Pru.Δhxgprt.tdTOMATOprom TUB.SAG1ΔGPI-OVA[140-386]prom TUB/3’utr DHFR +BLE | (Schaeffer et al., 2009) | N/A |
| T. gondii: Tg.pGRA6/GRA6-OVA: Pru.Δhxgprt.tdTOMATOprom TUB.GRA6II-LEQLE-SIINFEKLprom GRA6/3’utr GRA2 +HXGPRT | This study | N/A |
| T. gondii: Tg.GFP: Pru.Δhxgprt.GFPprom GRA1.click beetle LUCprom DHFR | (Kim et al., 2007) | N/A |
| T. gondii: Tg.pGRA6/GRA6-OVA: Pru.Δhxgprt.GFPprom GRA1.click beetle LUCprom DHFR.GRA6II-LEQLE-SIINFEKLprom GRA6/3’utr GRA2 +HXGPRT | This study | N/A |
| T. gondii: Tg.pSAG1/GRA6-OVA: Pru.Δhxgprt.GFPprom GRA1.click beetle LUCprom DHFR.GRA6II-LEQLE-SIINFEKLprom SAG1/3’utr GRA2 +HXGPRT | This study | N/A |
| Oligonucleotides | ||
| TOX9: 5’-AGGAGAGATATCAGGACTGTAG | (Feliu et al., 2013) | N/A |
| TOX11: 5’-GCGTCGTCTCGTCTAGATCG | (Feliu et al., 2013) | N/A |
| pri58-F: 5’-TTCCGAGCAGGTGACCTGGGTC | This study | N/A |
| pri92-R: 5’-CGTACGGGTACCATGGTTACAGTTTTTCAAAGTTGATTATACTCTCAAGCTGCTCAAGAAAATCAAACTCATTCACACTTCCCGGGT | This study | N/A |
| pri28F : 5’-CTAGATACCGTTCGTATAATGTATGCTATACGAAGTTATACTAGTGCTAGCATAACTTCGTATAATGTATGCTATACGAACGGTAT | This study | N/A |
| pri29R : 5’-CTAGATACCGTTCGTATAGCATACATTATACGAAGTTATGCTAGCACTAGTATAACTTCGTATAGCATACATTATACGAACGGTAT | This study | N/A |
| Recombinant DNA | ||
| pLd4 | (Evans et al., 1982), T. Hansen | internal ID: NBpla93 |
| pLd4Lox | This study | internal ID: NBpla100 |
| pGRA6/GRA6-OVA | This study | internal ID: NBpla119 |
| pSAG1/GRA6-OVA | This study | internal ID NBpla190 |
| Software and Algorithms | ||
| ImageJ | NIH | N/A |
| FlowJo | TreeStar | N/A |
| Prism | GraphPad | N/A |