Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
mRNA primers used for ddPCR.
| Gene reference name | Gene full name | Product size (bp) | GenBank accession # | Primer sequence—forward and reverse (5′-3′) | Efficiency (%) | Source |
|---|---|---|---|---|---|---|
| CX37 | Connexin 37/Gap junction protein alpha 4 | 221 | NM_001083738.1 | F: GACTCATCTCCCTGGTGCTC R: GTTCTGCTCACTGGACGACA |
97.00 | Yuan et al., 2008 |
| CX43 | Connexin 43/Gap junction protein alpha 1 | 104 | NM_174068 | F: GTCTTCGAGGTGGCCTTCTTG R: AGTCCACCTGATGTGGGCAG |
101.90 | Tesfaye et al., 2007 |
