| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rat anti-mouse CD4 Alexa Fluor 700 (Clone: GK1.5) | BioLegend | Cat# 100430; RRID: AB_493699 |
| Rat anti-mouse/human CD45R/B220 BV785 (Clone: RA3-6B2) | BioLegend | Cat# 103246; RRID: AB_2563256 |
| Rat anti-mouse/human CD45R/B220 BV421 (Clone: RA3-6B2) | BioLegend | Cat# 103251; RRID: AB_2562905 |
| Rat anti-mouse CXCR5 biotin (Clone: L138D7) | BioLegend | Cat# 145510; RRID: AB_2562126 |
| eBioscience Rat anti-mouse CXCR5 biotin (Clone: SPRCL5) | Thermo Fisher Scientific | Cat# 12-7185-82; RRID: AB_2572800 |
| Mouse anti-rat CD90/mouse CD90.1 Alexa Fluor 488 (Clone: OX-7) | BioLegend | Cat# 202506; RRID: AB_492882 |
| Mouse anti-rat CD90/mouse CD90.1 BV650 (Clone: OX-7) | BioLegend | Cat# 202533; RRID: AB_2562254 |
| eBioscience Rat anti-mouse/rat FOXP3 PE-Cy7 (Clone: FJK-16s) | Thermo Fisher Scientific | Cat# 25-5773-82; RRID: AB_891552 |
| Mouse anti-human Bcl6 Alexa Fluor 647 (Clone: K112-91) | BD Biosciences | Cat# 561525; RRID: AB_10898007 |
| Rat anti-mouse/human GL7 PerCP-Cy5.5 (Clone: GL7) | BioLegend | Cat# 144610; RRID: AB_2562979 |
| Hamster anti-mouse CD95 BV510 (Clone: Jo2) | BD Biosciences | Cat# 563646; RRID: AB_2738345 |
| Hamster anti-mouse CD95 PE (Clone: Jo2) | BD Biosciences | Cat# 554258; RRID: AB_395330 |
| Rat anti-mouse IgD PE-Cy7 (Clone: 11–26c.2a) | BioLegend | Cat# 405720; RRID: AB_2561876 |
| Rat anti-mouse CD138 BV650 (Clone: 281–2) | BioLegend | Cat# 142518; RRID: AB_2650927 |
| Rat anti-mouse PD-1 BV605 (Clone: 29F.1A12) | BioLegend | Cat# 135220; RRID: AB_2562616 |
| Rat anti-mouse CD8a APC/Fire 750 (Clone 53–6.7) | BioLegend | Cat# 100766; RRID: AB_2572113 |
| Rat anti-mouse CD4 APC/Fire 750 (Clone: GK1.5) | BioLegend | Cat# 100460; RRID: AB_2572111 |
| Rat anti-mouse Ly-6G/Ly-6C APC/Fire 750 (Clone RB6-8C5) | BioLegend | Cat# 108456; RRID: AB_2616737 |
| Mouse anti-mouse NK-1.1 APC/Fire 750 (Clone: S17016D) | BioLegend | Cat# 156516; RRID: AB_2892323 |
| Rat anti-mouse CD3 APC/Fire 750 (Clone: 17A2) | BioLegend | Cat# 100248; RRID: AB_2572118 |
| Rat anti-mouse/human CD44 PerCP-Cy5.5 (Clone: IM7) | BioLegend | Cat# 103032; RRID: AB_2076204 |
| Rat anti-mouse CD62L BV510 (Clone: MEL-14) | BD Biosciences | Cat# 563117; RRID: AB_2738013 |
| Mouse anti-mouse CD45.1 BUV395 (Clone: A20) | BD Biosciences | Cat# 565212; RRID: AB_2722493 |
| Mouse anti-mouse CD45.2 BUV395 (Clone: 104) | BD Biosciences | Cat# 564616; RRID: AB_2738867 |
| Hamster anti-mouse CD69 Alexa Fluor 488 (Clone: H1.2F3) | BD Biosciences | Cat# 104516; RRID: AB_492845 |
| Ultra-LEAF purified hamster anti-mouse CD154 (Clone: MR1) | BioLegend | Cat# 106517; RRID: AB_2813947 |
| Mouse anti-mouse CD45.1 FITC (Clone: A20) | BioLegend | Cat# 110706; RRID: AB_313495 |
| Mouse anti-mouse CD45.2 Alexa Fluor 647 (Clone: 104) | BioLegend | Cat# 109818 RRID: AB_492870 |
| Mouse anti-mouse TCR Vβ12 PE (Clone: MR11-1) | BioLegend | Cat# 139704; RRID: AB_10639729 |
| Purified rat anti-mouse CD16/Cd32 (Mouse BD Fc Block™) (Clone: 2.4G2) | BD Biosciences | Cat# 553141; RRID: AB_394656 |
| Peroxidase AffiniPure donkey anti-human IgG (H + L) | Jackson ImmunoResearch | Cat# 709-035-149; RRID: AB_2340495 |
| Peroxidase AffiniPure goat anti-mouse IgG (H + L) | Jackson ImmunoResearch | Cat# 115-035-166; RRID: AB_2338511 |
| Peroxidase AffiniPure goat anti-human IgG, Fcγ fragment specific | Jackson ImmunoResearch | Cat# 109-035-098; RRID: AB_2337586 |
| TotalSeq-C0301 anti-mouse Hashtag 1 Antibody (Clone: M1/42, 30-F11) | BioLegend | Cat# 155861; RRID: AB_2800693 |
| TotalSeq-C0302 anti-mouse Hashtag 1 Antibody (Clone: M1/42, 30-F11) | BioLegend | Cat# 155863; RRID: AB_2800694 |
| TotalSeq-C0303 anti-mouse Hashtag 1 Antibody (Clone: M1/42, 30-F11) | BioLegend | Cat# 155865; RRID: AB_2800695 |
| TotalSeq-C0304 anti-mouse Hashtag 1 Antibody (Clone: M1/42, 30-F11) | BioLegend | Cat# 155867; RRID: AB_2800696 |
| TotalSeq-C0305 anti-mouse Hashtag 1 Antibody (Clone: M1/42, 30-F11) | BioLegend | Cat# 155869; RRID: AB_2800697 |
| Bacterial and virus strains | ||
| NEB 5-alpha Competent E. coli (High Efficiency) | New England BioLabs | Cat# C2987H |
| 92TH021 from 6 HIV-1 Env-pseudotyped virus panel with N276 glycan mutation | Elise Landais IAVI-NAC (elandais@iavi.org) | Simek et al. (2009) |
| Viruses from tiered HIV-1 Env-pseudotyped viruses with N276 glycan mutation | Elise Landais IAVI-NAC (elandais@iavi.org) | Seaman et al. (2010) |
| BG505.W6M.ENV.C2 (BG505) with N276 glycan mutations | Elise Landais IAVI-NAC (elandais@iavi.org) | Hoffenberg et al. (2013) |
| Chemicals, peptides, and recombinant proteins | ||
| BG505 MD39-GT3.1 SOSIP | This paper | Produced in house |
| BG505 SOSIPv4.1-GT1 | Medina-Ramírez et al. (2017) | Produced in house |
| BG505 MD39 SOSIP | Steichen et al. (2016) | Produced in house |
| BG505 MD39 SOSIP-Biotin | Steichen et al. (2016) | Produced in house |
| BG505 MD39-N276D SOSIP-biotin | This paper | Produced in house |
| BG505 MD39 Ferritin nanoparticle | This paper and Tokatlian et al. (2019) | Produced in house |
| BG505 MD39-N276D Ferritin nanoparticle | This paper and Tokatlian et al. (2019) | Produced in house |
| BG505 MD39-N276A Ferritin nanoparticle | This paper and Tokatlian et al. (2019) | Produced in house |
| RM19R Fab | Cottrell et al. (2020) | Produced in house |
| PKVSFEPIPIHYCAP | A&A Labs LLC | Custom |
| BG505-MD39 SOSIP peptide megapool | A&A Labs LLC | Custom |
| Pierce Protein A Agarose | Thermo Fisher Scientific | Cat# 20334 |
| CaptureSelect CH1-XL Affinity Matrix | Thermo Fisher Scientific | Cat# 1943462005 |
| Sigma Adjuvant System | Sigma Aldrich | Cat# S6322-1VL |
| Alhydrogel adjuvant 2% | InvivoGen | Cat# vac-alu-250 |
| 1-Step Ultra TMB-ELISA Substrate Solution | Thermo Fisher Scientific | Cat# 34028 |
| TMB Chromogen Solution (for ELISA) | Thermo Fisher Scientific | Cat# 002023 |
| Phosphatase substrate | Sigma Aldrich | Cat# S0942 |
| Bovine Serum Albumin | Sigma Aldrich | Cat# A7030-5KG |
| Fetal Bovine Serum | Thermo Fisher Scientific | Cat# 16000044 |
| BD Difco™ Skim Milk | BD Life Sciences | Cat# 232100 |
| Sulfuric Acid, 2.00 Normal | RICCA Chemical Company | Cat# 8310–32 |
| Streptavidin | Jackson ImmunoResearch | Cat# 016-000-084; RRID: AB_2337233 |
| Lectin from Galanthus nivalis (snowdrop), lyophilized powder | Sigma-Aldrich | Cat# L8275-5mg |
| HBS-EP+ 20×, pH 7.6 | Teknova | Cat# H8022 |
| FuGENE 6 Transfection Reagent | Promega | Cat# E2692 |
| Octet Kinetics Buffer 10X | Sartorius | Cat# 18–1105 |
| BV421 Streptavidin | BioLegend | Cat# 405225 |
| eBioscience Propidium Iodide Staining Solution | Thermo Fisher Scientific | Cat# 00-6990-50 |
| eBioscience Fixable Viability Dye eFluor 780 | Thermo Fisher Scientific | Cat# 65-0865-14 |
| M1 antibody | This paper | Produced in house |
| M2 antibody | This paper | Produced in house |
| M3 antibody | This paper | Produced in house |
| M4 antibody | This paper | Produced in house |
| M5 antibody | This paper | Produced in house |
| M6 antibody | This paper | Produced in house |
| M7 antibody | This paper | Produced in house |
| M8 antibody | This paper | Produced in house |
| M9 antibody | This paper | Produced in house |
| M10 antibody | This paper | Produced in house |
| M11 antibody | This paper | Produced in house |
| M12 antibody | This paper | Produced in house |
| M13 antibody | This paper | Produced in house |
| E1 antibody | Abbott et al. (2018) | Produced in house |
| E2 antibody | Abbott et al. (2018) | Produced in house |
| E3 antibody | Abbott et al. (2018) | Produced in house |
| E4 antibody | Abbott et al. (2018) | Produced in house |
| E5 antibody | Abbott et al. (2018) | Produced in house |
| E6 antibody | Abbott et al. (2018) | Produced in house |
| E7 antibody | Abbott et al. (2018) | Produced in house |
| E8 antibody | Abbott et al. (2018) | Produced in house |
| E9 antibody | Abbott et al. (2018) | Produced in house |
| E10 antibody | Abbott et al. (2018) | Produced in house |
| E11 antibody | Abbott et al. (2018) | Produced in house |
| Critical commercial assays | ||
| Pierce Fab Preparation Kit | Thermo Fisher Scientific | Cat# 44985 |
| eBioscience FoxP3/Transcription Factor Staining Buffer Set | Thermo Fisher Scientific | Cat# 00-5523-00 |
| BD Cytofix Fixation Buffer | BD Biosciences | Cat# 554655 |
| Luciferase Assay System | Promega | Cat# E4550 |
| EasySep Mouse CD4+ T Cell Isolation Kit | STEMCELL Technologies | Cat# 19852 |
| EasySep Mouse B Cell Isolation Kit | STEMCELL Technologies | Cat# 19854 |
| Alexa Fluor 647 Protein Labeling Kit | Thermo Fisher Scientific | Cat# A20173 |
| Chromium Single Cell V(D)J Enrichment Kit, Mouse B Cell, 96 rxns | 10X Genomics | Cat# 1000072 |
| Chromium Single Cell 5′ Library & Gel Bead Kit, 4 rxns | 10X Genomics | Cat# 1000014 |
| Chromium Single Cell A Chip Kit, 16 rxns | 10X Genomics | Cat# 1000009 |
| Chromium Single Cell 5′ Feature Barcode Library Kit, 16 rxns | 10X Genomics | Cat# 1000080 |
| Chromium i7 Multiplex Kit, 96 rxns | 10X Genomics | Cat# 120262 |
| Chromium i7 Multiplex Kit N Set A, 96 rxns | 10X Genomics | Cat# 1000084 |
| SuperScript II Reverse Transcriptase | Thermo Fisher | Cat# 18064071 |
| Phusion Green High-Fidelity DNA Polymerase | Thermo Fisher | Cat# F534L |
| Hot StarTaq Master Mix Kit (2500 U) | Qiagen | Cat# 203446 |
| ExpiCHO Expression System Kit | Thermo Fisher Scientific | Cat# A29133 |
| Human Antibody Capture Kit | Cytvia | Cat# BR100839 |
| BirA biotin-protein ligase standard reaction kit | Avidity Inc | Cat# BirA500 |
| Deposited data | ||
| VRC01gHL HC sequences | This Paper | Genbank: OM484270 – OM484649 |
| VRC01gHL LC sequences | This Paper | Genbank: OM484650 – OM484939 |
| 10X Genomics BCR sequencing data | This Paper | BioProject: PRJNA802246 |
| Experimental models: Cell lines | ||
| Human: HeLa-derived TZM-bl | NIH AIDS Reagent Program | Cat# 8129–442; RRID: CVCL_B478 |
| Human: HEK293T | ATCC | Cat# CRL-3216; RRID: CVCL_0063 |
| Human: HEK293S GnTI−/− | ATCC | Cat# CRL-3022; RRID: CVCL_A785 |
| Human: FreeStyle 293F | Thermo Fisher Scientific | Cat# R79007; RRID: CVCL_D603 |
| Hamster: ExpiCHO-S | Thermo Fisher Scientific | Cat# A29132; RRID: CVCL_5J31 |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J mice | The Jackson Laboratory | JAX: 000664 |
| Mouse: VRC01gHL | Abbott et al. (2018) | NA |
| Mouse: B6.SJL-PtprcaPepcb/BoyJ | The Jackson Laboratory | JAX: 002014 |
| Mouse: B6.PL-Thy1a/CyJ | The Jackson Laboratory | JAX: 000406 |
| Mouse: HYCAP1 | Lee et al., 2021 | NA |
| Mouse: HYCAP3 | Lee et al., 2021 | NA |
| Oligonucleotides | ||
| 1st PCR mouse IgH forward primer 1mFH_VII: CCTGTCAGTAACTRCAGGTGTCC | von Boehmer et al. (2016) | NA |
| 1st PCR mouse IgG constant region reverse primer 1mRG: AGAAGGTGTGCACACCGCTGGAC | von Boehmer et al. (2016) | NA |
| 1st PCR mouse IgK forward primer 1mFK_I: RGTGCAGATTTTCAGCTTCCTGCT | von Boehmer et al. (2016) | NA |
| 1st PCR mouse IgK constant region reverse primer 1mRK: ACTGAGGCACCTCCAGATGTT | von Boehmer et al. (2016) | NA |
| 2nd PCR mouse IgH forward primer 2mFG: GGGAATTCGAGGTGCAGCTG CAGGAGTCTGG |
von Boehmer et al. (2016) | NA |
| 2nd PCR mouse IgG constant region reverse primer 2mRG: GCTCAGGGAARTAGCCCTTGAC | von Boehmer et al. (2016) | NA |
| 2nd PCR mouse IgK forward primer 2mFK: GAYATTGTGMTSACMCARWCTMCA | von Boehmer et al. (2016) | NA |
| 2nd PCR mouse IgK reverse primer 2mRK: TGGGAAGATGGATACAGTT | von Boehmer et al. (2016) | NA |
| Human IGKV3-11 FWR2 specific forward sequencing primer: GAAATTGTGTTGACACAGTCTCC | Abbott et al. (2018) | NA |
| VRC01 LCDR3 specific reverse sequencing primer: CGAAGAACTCGTACTGCTGAC | Abbott et al. (2018) | NA |
| Software and algorithms | ||
| Cell Ranger | 10X Genomics | https://support.10xgenomics.com/ingles-cell-gene-expression/software/overview/welcome |
| Hashtag count | Lee et al., 2021b | https://github.com/jvxtaposed/Filter-Cellranger-VDJ |
| ARMADiLLO | Wiehe et al. (2018) | Software provided by publisher |
| Unipro UGENE | Okonechnikov et al. (2012) | http://ugene.net |
| Data Analysis HT software v11.1 | Sartorius | https://www.sartorius.com |
| ProteOn™ Manager Software | Bio-Rad Laboratories | https://bio-rad.com |
| FlowJo v10 | FlowJo | https://www.flowjo.com/ |
| Adobe Illustrator CS | Adobe | https://www.adobe.com |
| Prism 8 | GraphPad | https://www.graphpad.com |
| Microsoft Office Excel | Microsoft | https://www.microsoft.com |
| FACSDiva | BD Bioscience | https://www.bdbiosciences.com |
| Other | ||
| Octet SA Biosensors | Sartorius | Cat# SA |
| Costar Assay Plate, 96 well flat-bottom, half area, high binding | Corning | Cat# 3690 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.