Table 2.
Primers used to amplify the mecA gene
| Primers 5’ – 3’ | 5’ – 3’ primer sequence | Amplicon size |
|---|---|---|
| mecA forward primer | TCCAGATTACAACTTCACCAGG | 162 bp |
| mecA reverse primer | CCACTTCATATCTTGTAACG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.