| Genetic reagent (Danio rerio) |
Tg[hsp:gal4]kca4
|
PMID: 11850174 |
ZDB-ALT-020918-6 |
Reugels/Campos-Ortega lab (Köln University) |
| Genetic reagent (Danio rerio) |
Tg[UAS:EGFP]
|
PMID: 11336499 |
N/A |
|
| Genetic reagent (Danio rerio) |
Tg[UAS:MYFP]
|
PMID: 1702063 |
N/A |
|
| Genetic reagent (Danio rerio) |
Tg[ath5:GFP] rw021
|
PMID: 12702661 |
N/A |
|
| Genetic reagent (Danio rerio) |
Tg[ptf1a:mCherry-CAAX]oki067
|
This paper |
N/A |
See ‘Materials and methods’ |
| Genetic reagent (Danio rerio) |
Tg[Gal4-VP16,UAS:EGFP]xfz43 or xfz43
|
PMID: 19712466 |
ZDB-ALT-100201-1 |
ZIRC |
| Genetic reagent (Danio rerio) |
Tg[Gal4-VP16,UAS:EGFP]xfz3 or xfz3
|
PMID: 19712466 |
ZDB-ALT-100201-2 |
ZIRC |
| Genetic reagent (Danio rerio) |
Tg[hs:mCherry-tagged Bcl2]oki029
|
PMID: 33060680 |
ZDB-ALT-210524-5 |
|
| Genetic reagent (Danio rerio) |
Tg[hsp:WT.Strip1-GFP] oki068
|
This paper |
N/A |
See ‘Materials and methods’ |
| Genetic reagent (Danio rerio) |
Tg[hsp:Mut.Strip1-GFP] oki069
|
This paper |
N/A |
See ‘Materials and methods’ |
| Genetic reagent (Danio rerio) |
strip1rw147
|
This paper |
N/A |
See ‘Materials and methods’ |
| Genetic reagent (Danio rerio) |
strip1crisprΔ10 or strip1oki8
|
This paper |
N/A |
See ‘Materials and methods’ |
| Genetic reagent (Danio rerio) |
roy
|
PMID: 28760346 |
ZDB-GENE-040426-1168 |
|
| Antibody |
anti-acetylated α-tubulin (mouse monoclonal) |
Sigma-Aldrich |
T6793 |
IF: 1:1000 |
| Antibody |
anti-Pax6 (rabbit polyclonal) |
BioLegned |
901,301 |
IF: 1:500 |
| Antibody |
anti-Prox1 (rabbit polyclonal) |
Genetex |
GTX128354 |
IF: 1:500 |
| Antibody |
anti-PCNA (mouse monoclonal) |
Sigma-Aldrich |
P8825 |
IF: 1:200 |
| Antibody |
Zpr1 (mouse monoclonal) |
ZIRC |
ZDB-ATB-081002-43 |
IF: 1:100 |
| Antibody |
Zpr3 (mouse monoclonal) |
ZIRC |
ZDB-ATB-081002-45 |
IF: 1:100 |
| Antibody |
anti-glutamine synthetase (mouse monoclonal) |
Sigma-Aldrich |
MAB302 |
IF: 1:150 |
| Antibody |
Zn5 (mouse monoclonal) |
ZIRC |
ZDB-ATB-081002-19 |
IF: 1:50 |
| Antibody |
anti-parvalbumin (mouse monoclonal) |
Merck Millipore |
MAB1572 |
IF: 1:500 |
| Antibody |
anti-p-Jun (rabbit polyclonal) |
Cell Signaling |
9164S |
IF: 1:100 |
| Antibody |
anti-Strip1 (rabbit polyclonal) |
This paper |
N/A |
See ‘Materials and methods’IF: 1:1000WB: 1:500 |
| Antibody |
anti-rabbit Alexa 488 secondary antibody (goat polyclonal) |
Life Technologies |
A11034 |
IF: 1:500 |
| Antibody |
anti-mouse Alexa 488 secondary antibody (goat polyclonal) |
Life Technologies |
A11029 |
IF: 1:500 |
| Antibody |
anti-mouse Alexa 546 secondary antibody (goat polyclonal) |
Life Technologies |
A11030 |
IF: 1:500 |
| Antibody |
anti-mouse Alexa 647 secondary antibody (goat polyclonal) |
Life Technologies |
A21236 |
IF: 1:500 |
| Antibody |
anti-rabbit IgG, HRP-linked Antibody (goat polyclonal) |
Cell Signaling |
7074 |
WB: 1:5000 |
| Antibody |
anti-GFP (rabbit polyclonal) |
Thermo Fisher Scientific |
A11122 |
WB: 1:500 |
| Antibody |
anti-Strn3 (rabbit polyclonal) |
Thermo Fisher Scientific |
PA5-31368 |
WB: 1:1000 |
| Antibody |
anti β-actin (mouse monoclonal) |
Merck Millipore |
A5441 |
WB: 1:5000 |
| Antibody |
anti β-actin (rabbit polyclonal) |
Abcam |
AB8227 |
WB: 1:5000 |
| Recombinant DNA reagent |
pTol2[ptf1a:mCherry-CAAX](plasmid) |
This paper |
N/A |
See ‘Materials and methods’ |
| Recombinant DNA reagent |
pG1[ptf1a:GFP](plasmid) |
PMID: 23035102 |
N/A |
Francesco Argenton Laboratory (University of Padova) |
| Recombinant DNA reagent |
pTol2[hsp:WT.Strip1-GFP](plasmid) |
This paper |
N/A |
See ‘Materials and methods’ |
| Recombinant DNA reagent |
pTol2[hsp:Mut.Strip1-GFP](plasmid) |
This paper |
N/A |
See ‘Materials and methods’ |
| Recombinant DNA reagent |
pBluescript SK (+)(plasmid) |
Stratagene |
N/A |
|
| Recombinant DNA reagent |
pT2AL200R150G(plasmid) |
PMID: 16959904 |
N/A |
Dr. Koichi Kawakami (Institute of Genetics) |
| Recombinant DNA reagent |
pB[ath5:Gal4-VP16](plasmid) |
This paper |
N/A |
See ‘Materials and methods’ |
| Recombinant DNA reagent |
pZNYX-Gal4VP16(plasmid) |
PMID: 17020638 |
N/A |
Rachel Wong Laboratory(University of Washington) |
| Sequence-based reagent |
Standard control MO (STD-MO) |
GeneTools |
N/A |
5′-CCTCTTACCTCAGTTACAATTTATA-3′Same concentration for each MO experiment |
| Sequence-based reagent |
Strip1 morpholino (MO-strip1) |
GeneTools |
N/A |
5′- TAGCACATAAACCGACACCGTCCAT-3′250 μM |
| Sequence-based reagent |
Ath5 morpholino (MO-ath5) |
GeneTools |
ZDB-MRPHLNO-100405-2 |
5′-TTCATGGCTCTTCAAAAAAGTCTCC-3′250 μM |
| Sequence-based reagent |
Striatin3 morpholino (MO-strn3) |
GeneTools |
N/A |
5′- CCTGCTAGAAGTCGCCGATTGTTAC -3′250 μM |
| Sequence-based reagent |
Jun morpholino (MO-jun) |
GeneTools |
ZDB-MRPHLNO-080908-1 |
5′- CTTGGTAGACATAGAAGGCAAAGCG -3′125 μM |
| Peptide, recombinant protein |
Cas9 protein |
FASMAC |
GE-006-S |
|
| Commercial assay or kit |
JB-4 Embedding Kit |
Polysciences |
00226-1 |
|
| Commercial assay or kit |
In Situ Cell Death Detection Kit, TMR Red |
Roche |
12156792910 |
|
| Commercial assay or kit |
In Situ Cell Death Detection Kit, Fluorescein |
Roche |
11684795910 |
|
| Commercial assay or kit |
DIG RNA Labeling Kit |
Roche |
11277073910 |
|
| Commercial assay or kit |
GFP Trap Agarose |
Chromotek |
gta-20 |
|
| Commercial assay or kit |
Arcturus PicoPure RNA Isolation Kit |
Thermo Fisher Scientific |
KIT0204 |
|
| Commercial assay or kit |
NEB Next Ultra II Directional RNA Library Prep Kit |
New England BioLabs |
E7760L |
|
| Chemical compound, drug |
Acridine Orange (AO) |
Nacalai tesque |
1B-307 |
5 μg/ml |
| Chemical compound, drug |
CellTrace BODIPY TR Methyl Ester |
Thermo Fisher Scientific |
C34556 |
100 nM |
| Chemical compound, drug |
Ethyl-3-aminobenzoate de methanesulfonate (Tricaine, MS-222) |
Nacalai tesque |
14805-82 |
0.02% |
| Chemical compound, drug |
PTU (N-Phenylthiourea) |
Nacalai tesque |
27429-22 |
0.003% |
| Chemical compound, drug |
Fast DiO solid |
Thermo Fisher Scientific |
D3898 |
2 mg/ml |
| Chemical compound, drug |
Fast DiI solid |
Thermo Fisher Scientific |
D7756 |
2 mg/ml |
| Chemical compound, drug |
TO-PRO-3 Iodide (642/661) |
Thermo Fisher Scientific |
T3605 |
1 nM |
| Chemical compound, drug |
Hoechst 33,342 |
Wako |
346-07951 |
1 ng/ml |
| Chemical compound, drug |
Toluidine Blue |
Nacalai tesque |
1B-481 |
|
| Chemical compound, drug |
Dextran, Tetramethylrhodamine |
Thermo Fisher Scientific |
D1817 LTJ |
|
| Chemical compound, drug |
Dextran, Alexa Flour-488 |
Thermo Fisher Scientific |
D22910 |
|
| Chemical compound, drug |
Dextran, Alexa Flour-647 |
Thermo Fisher Scientific |
D22914 |
|
| Chemical compound, drug |
Dextran, Cascade Blue |
Thermo Fisher Scientific |
D1976 |
|
| Software, algorithm |
chopchop |
chopchop |
https://chopchop.cbu.uib.no
|
|
| Software, algorithm |
ImageJ (Fiji) |
PMID: 22930834 |
https://imagej.nih.gov/ij/; RRID: SCR_003070
|
|
| Software, algorithm |
Imaris |
Bitplane |
http://www.bitplane.com/imaris; RRID: SCR_007370
|
|
| Software, algorithm |
Proteome Discoverer |
Thermo |
https://www.thermofisher.com/store/products/OPTON-30945#/OPTON-30945 |
|
| Software, algorithm |
STRING |
PMID: 27924014 |
https://string-db.org
|
|
| Software, algorithm |
Metascape |
PMID: 30944313 |
https://metascape.org
|
|
| Software, algorithm |
BioVenn |
PMID: 18925949 |
http://www.biovenn.nl/
|
|
| Software, algorithm |
GraphPad Prism v9.1.0. |
GraphPad Prism |
https://www.graphpad.com/scientific-software/prism/
|
|
