Skip to main content
. 2022 Mar 24;10:52. doi: 10.1186/s40168-022-01235-w

Table 1.

FISH probes used in this study

Probe Target taxon Probe sequence 5′–3′ Fluorophore Reference
Eub338-I Bacteria GCTGCCTCCCGTAGGAGT Dy490 or Atto532 [22]
Eub338-II Planctomycetes GCAGCCACCCGTAGGTGT Dy415 [23]
Eub338-III Verrucomicrobia GCTGCCACCCGTAGGTGT Dy415 [23]
Alf968 Alphaproteobacteria GGTAAGGTTCTGCGCGTT Dy490 or Atto620 [24]
Gam42a Gammaproteobacteria GCCTTCCCACATCGTTT Cy5 [25]
Bac1058 Bacteroidetes TGAATGGCTGCTTCCAAGCCAACA Rhodamine Red-X [26]
Gran737 Granulosicoccus sp. TCAGCGTCAGTATTGTTCCAGA Texas Red-X This study
Gran670 Granulosicoccus sp. CACCGCTACACCCGGAATTCCGC Texas Red-X This study

Probe name, target taxon, 5′–3′ sequence, fluorophores used, and references are indicated