Table 1.

Mature miRNA sequences.

Gene	Forward Primer Sequence (5′-3′)	Genbank Accession Number	Location	Temperature °C
hsa-miR-33a-3p	CAATGTTTCCACAGTGCATCAC	NR_029507	chr 22 q13.2	55
hsa-miR-223-5p	CGTGTATTTGACAAGCTGAGTT	LM608368	chr X q12	55
hsa-miR-142-5p	CATAAAGTAGAAAGCACTACT	NR_029683	chr 17 q22	55
hsa-miR-199a-5p	CCCAGTGTTCAGACTACCTGTTC	NR_029586	chr 19 p13.2	55
hsa-miR-4454	GGATCCGAGTCACGGCACCA	NR_039659	chr 4 q32.2	55
hsa-miR-181a-5p	AACATTCAACGCTGTCGGTGAGT	NC_000009.12	chr 22 1q32.1	55

Table Legend. hsa-miR-33a-3p: homo sapiens microRNA-33a with 3p strand present in the reverse position; hsa-miR-223-5p: homo sapiens microRNA-223 with 5p strand present in the forward position; hsa-miR-142-5p: homo sapiens microRNA-142 with 5p strand present in the forward position; hsa-miR-199a-5p: homo sapiens microRNA-199a with 5p strand present in the forward position; hsa-miR-4454: homo sapiens microRNA-4454; hsa-miR-181a-5p: homo sapiens microRNA-181a with 5p strand present in the forward position.