Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Caenorhabditis elegans) | C. elegans N2 Bristol | Caenorhabditis Genetics Center(CGC) | http://www.cgc.cbs.umn.edu/strain.php?id=10570 | |
| Strain, strain background (C. elegans) | mCherry::NPP-22 npp-22(syb1474)V | SunyBiotech | PHX1774 | |
| Strain, strain background (C. elegans) | mCherry::LMN-1; GFP::TBB-2:[mCherry::lmn-1] MosSCI: jfSi68[lmn-1(4 kb 5’UTR)::mCherry::lmn-1gDNA exon four recoded::3’UTR lmn-1 cb-unc-119(+)]II; ojIs1[Ppie-1_gfp::tbb-2]; unc-119(ed3)III | Pintard labThis study | WLP996 | |
| Strain, strain background (C. elegans) | mCherry::NPP-22; GFP::TBB-2: ojIs1[Ppie-1_gfp::tbb-2, cb-unc-119(+)]; unc-119(ed3)III; mCherry::npp-22(syb1474)V | Pintard labThis study | WLP993 | |
| Strain, strain background (Caenorhabditis elegans) | mCherry::HIS-58; GFP::TBB-2: ojIs1[Ppie-1_gfp::tbb-2]; unc-119(ed3)III; ltIs37[pAA64; Ppie1_mCherry::his-58; unc-119 (+)]IV | CGC | JCC483 | |
| Strain, strain background (C. elegans) | GFP::LMN-1; mCherry::Histone: lmn-1(tm1502)I; jfSi68[Plmn-1::gfp cb-unc-119(+)]II; mCherry::his-58 IV | Link et al., 2018 | UV142 | |
| Strain, strain background (C. elegans) | GFP::LMN-1 8A; mCherry::Histone: lmn-1(tm1502)I;jfSi89[Plmn-1S(21,22,24,32,397,398,403, 405)A::gfp cb-unc-119(+)]II; mCherry::his-58 IV | Link et al., 2018 | UV144 | |
| Strain, strain background (C. elegans) | GFP::LEM-2; mCherry::HIS-58:Itls37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)]IV qals3507 [pie-1::GFP::LEM-2 + unc-119(+)] | CGC | OD83 | |
| Strain, strain background (C. elegans) | lmn-1 8A; GFP::LEM-2; mCherry::HIS-58:lmn-1S8A S(21,22,24,32,397,398,403, 405)A Itls37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)]IV qals3507 [pie-1::GFP::LEM-2 + unc-119(+)] | Velez-Aguilera et al., 2020 | WLP833 | |
| Strain, strain background (C. elegans) | GFP::LEM-2; mCherry::EMR-1:bqSi210 [lem-2p::lem-2::GFP + unc-119(+)] II; bqSi226 [emr-1p::emr-1::mCherry + unc-119(+)]IV | Morales-Martínez et al., 2015 | BN228 | |
| Strain, strain background (C. elegans) | plk-1(or683ts); GFP::LEM-2; mCherry::EMR-1:bqSi210 [lem-2p::lem-2::GFP+unc-119(+)] II; plk-1(or683ts)III; bqSi226 [emr-1p::emr-1::mCherry + unc-119(+)] IV | Pintard lab This study | WLP1041 | |
| Strain, strain background (Escherichia coli) | OP50 | CGC | http://www.cgc.cbs.umn.edu/strain.php?id=11078 | |
| Strain, strain background (E. coli) | HT115(DE3) | CGC | http://www.cgc.cbs.umn.edu/strain.php?id=11078 | |
| Chemical compound, drug | IPTG | Euromedex | Cat#EU0008-B | |
| Chemical compound, drug | Pfu | Promega | Cat#M7741 | |
| Chemical compound, drug | DpnI | Biolabs | Cat#R0176S | |
| Commercial assay or kit | BP Clonase II Enzyme Mix (Gateway cloning) | Invitrogen | Cat#11789-020 | |
| Commercial assay or kit | LR Clonase II Enzyme Mix (Gateway cloning) | Invitrogen | Cat#11791-020 | |
| Recombinant DNA reagent | L4440 (RNAi Feeding vector) | Kamath et al., 2001 | N/A | |
| Recombinant DNA reagent | gpr-1/2 cloned into L4440 | Kamath et al., 2003 | Arhinger Library | |
| Recombinant DNA reagent | klp-7 cloned into L4440 | Kamath et al., 2003 | Arhinger Library | |
| Recombinant DNA reagent | efa-6 cloned into L4440 | Kamath et al., 2003 | Arhinger Library | |
| Recombinant DNA reagent | hcp-3 cloned into L4440 | Kamath et al., 2003 | Arhinger Library | |
| Recombinant DNA reagent | lmn-1 cloned into L4440 | Kamath et al., 2003 | Arhinger Library | |
| Recombinant DNA reagent | pDESTttTi5605[R4-R3] for MOS insertion on Chromosome II | Frøkjaer-Jensen et al., 2008 | pCFJ150Addgene plasmid # 19329 | |
| Recombinant DNA reagent | MOS transposase Pglh-2::MosTase::glh-2utr | Frøkjaer-Jensen et al., 2008 | pJL43.1Addgene plasmid # 19332 | |
| Recombinant DNA reagent | Prab-3::mCherry | Frøkjaer-Jensen et al., 2008 | pGH8 | |
| Recombinant DNA reagent | Pmyo-2::mCherry::unc-54 | Frøkjaer-Jensen et al., 2008 | pCFJ90 | |
| Recombinant DNA reagent | Plmn-1_gfp::lmn-1_lmn-1 3’UTR in pCFJ150 | Link et al., 2018 | N/A | |
| Recombinant DNA reagent | Plmn-1_gfp::lmn-1(S8A) lmn-1 3’UTR in pCFJ150 | Link et al., 2018 | N/A | |
| Recombinant DNA reagent | mCherry::lmn-1 in pCFJ150 | This study | pLP2437 | |
| Sequence-based reagent | Forward to amplify 5′ of mCherry | This study | OLP2570PCR primers | CTCTTCAGAAAGCAGCGAGAAAAATGGGA GGTAGGGCCGGCTCTG |
| Sequence-based reagent | Reverse to amplify 5′ of mCherry | This study | OLP2571PCR primers | CAGAGCCGGCCCTACCTCCCATTTTTCT CGCTGCTTTCTGAAGAG |
| Sequence-based reagent | Forward to amplify 3′ of mCherry with linker before LMN-1 | This study | OLP2572PCR primers | GGTGGCATGGATGAATTGTATAAGGCAAGT TTGTACAAAAAAGCAGGCTCC |
| Sequence-based reagent | oJD580 Amp_For to amplify fragment of PCFJ150 | This study | OLP870PCR primers | ATCGTGGTGTCACGCTCGTCGTTTGGTATGG |
| Sequence-based reagent | oJD581 Amp_Rev to amplify fragment of PCFJ151 | This study | OLP871PCR primers | ATACCAAACGACGAGCGTGACACCACGATGC |
| Sequence-based reagent | Gibson Forward oligo for MosII LMN-1 construction. | This study | OLP2267 | CCTTGTCCGAATCCACCACCCATTCCTCCTG |
| Sequence-based reagent | Gibson Reverse oligo for MosII LMN-1 construction. | This study | OLP2266 | GGAGGAATGGGTGGTGGATTCGGACAAGGAC |
| Software, algorithm | Adobe Illustrator CS6 | Adobe | https://www.adobe.com/products/illustrator.html | |
| Software, algorithm | Adobe Photoshop CS4 | Adobe | https://www.adobe.com/products/photoshop.html | |
| Software, algorithm | ImageJ | NIH Schneider et al., 2012 | https://imagej.nih.gov/ij/ | |
| Software, algorithm | ZEN | Zeiss | https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html | |
| Software, algorithm | PRISM | Graphpad | https://www.graphpad.com/ | |
| Software, algorithm | Metamorph | Molecular Devices | https://www.metamorph.com/ | |
| Software, algorithm | Imaris | Bitplane | Microscopy Image Analysis Software - Imaris - Oxford Instruments (oxinst.com) |