Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for PCR amplification.
| Genes | Primer sequences (5’→3′) |
|---|---|
| txtD | |
| Forward | catcatcatcaccatatgacctccgaagtcgctctgggccctt |
| Reverse | tgttagcagccggtcgacttactggtgggggtagaagttggggcgct |
| txtE | |
| Forward | catcatcatcaccatatgaccgtcccctcgccgctcgccga |
| Reverse | tgttagcagccggtcgacttagcggaggctgagcggcaggga |
