KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-VIP | ImmunoStar | Cat# 20077; RRID: AB_572270 |
| Mouse anti-reelin | MBL International | Cat# D223-3; RRID: AB_843523 |
| Mouse anti-PV | Sigma-Aldrich | Cat# P3088; RRID: AB_477329 |
| Rat anti-SST | MilliporeSigma | Cat# MAB354; RRID: AB_2255365 |
| Chicken anti-MBP | MilliporeSigma | Cat# AB9348; RRID: AB_2140366 |
| Rat anti-Ctip2 | Abcam | Cat# ab18465; RRID: AB_1001525 |
| Mouse anti-CRYM | Abcam | Cat# ab54669; RRID: AB_943673 |
| Rabbit anti-CCK | Frontier Institute, Japan | Cat# AB2571674; RRID: AB_2571674 |
| Goat anti-rabbit Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-21428; RRID: AB_141784 |
| Goat anti-rat Alexa Fluor 633 | Thermo Fisher Scientific | Cat# A-21094; RRID: AB_141553 |
| Goat anti-rat Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-21434; RRID: AB_141733 |
| Goat anti-mouse Alexa Fluor 633 | Thermo Fisher Scientific | Cat# A-21052; RRID: AB_2535719 |
| Goat anti-mouse Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-21422; RRID: AB_141822 |
| Goat anti-Chicken Alexa Flour 633 | Thermo Fisher Scientific | Cat# A-21103; RRID: AB_2535756 |
| Papain Dissociation System | Worthington Biochemical Corporation | Cat# LK003150 |
| Chromium Single Cell 3′ Library & Gel Bead Kit v2 | 10X Genomics | Cat# 120237 |
| Chromium Single Cell A Chip Kit | 10X Genomics | Cat# 120236 |
| Bacterial and Virus Strains | ||
| AAV9-Syn-FLEX-Chrimson-tdTomato | UNC Vector Core | N/A |
| G-deleted-rabies-mCherry-ChR2 | Salk Institute Gene, Transfer, Targeting and Therapeutics Core | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Carbachol | Sigma-Aldrich | Cat# 1092009 |
| Tetrodotoxin citrate | R&D Systems | Cat# 1078 |
| AP5 | Abcam | Cat# ab120271 |
| Deposited Data | ||
| Single cell RNA-sequencing | GEO: GSE127724 | |
| Experimental Models: Organisms/Strains | ||
| Mouse: 5HT3A-GFP | Charles Gerfen (Chittajallu et al., 2013) | N/A |
| Mouse: Tlx3(PL56)-Cre | Charles Gerfen (Gerfen et al., 2013) | N/A |
| Mouse: Emx1-IRES-Cre | The Jackson Laboratory | JAX: 005628 |
| Mouse: loxP flanked Satb2 | Rudolf Grosschedl (Srinivasan et al., 2012) | N/A |
| Mouse: LoxP flanked Lis1 | Anthony Wynshaw-Boris (Gambello et al., 2003) | N/A |
| Mouse: Sox2-Cre | The Jackson Laboratory | JAX: 008454 |
| Oligonucleotides | ||
| Primer: UNIV CRE 1: CAGAGACGGAAATCCATCGC | Invitrogen | N/A |
| Primer: UNIV CRE 2: GGTGCAAGTTGAATAACCGG | Invitrogen | N/A |
| Primer: Satb2 (flx fwd) AAGACTGCTGTGTGGGCTACAC | Invitrogen | N/A |
| Primer: Satb2 (flx rev) CACGTCCGTCCAAAGTTGCT | Invitrogen | N/A |
| Primer: Emx1-Cre: olMR1084 (MTfwd) GCG GTC TGG CAG TAA AAA CTA TC | Invitrogen | N/A |
| Primer: Emx1-Cre: olMR1085 (MTrvs) GTG AAA CAG CAT TGC TGT CAC TT | Invitrogen | N/A |
| Primer: Emx1-Cre: olMR4170 (WTfwd) AAG GTG TGG TTC CAG AAT CG | Invitrogen | N/A |
| Primer: Emx1-Cre: olMR4171 (WTrvs) CTC TCC ACC AGA AGG CTG AG | Invitrogen | N/A |
| Software and Algorithms | ||
| Seurat | Butler et al., 2018 | https://satijalab.org/seurat/ |
| Igor Pro | WaveMetrics | N/A |
| pClamp 10.6 | Molecular Devices | N/A |
| NeuroMatic | Rothman and Silver, 2018 | N/A |
| Morpheus | https://software.broadinstitute.org/morpheus/ | |
| Neurolucida | MicroBrightField | N/A |
| Simple Neurite Tracer for Fiji | Longair et al., 2011; Schindelin et al., 2012 | https://imagej.net/Simple_Neurite_Tracer |
| Imaris | Bitplane | N/A |
| Zen Black | Zeiss | N/A |
| Other | ||
| Retrobeads | Lumafluor | N/A |
| pE-4000 | CoolLED | N/A |