TABLE 1.

Primer sequences and PCR conditions used for streptogramin resistance genes

Primer	Sequence (5′–3′)	GenBank accession no. and/or gene	Position of amplicon	PCR conditions	Reference(s)
vat-1	TGGAGTGTGACAAGATAGGC	L07778	200–712	Same as for vat(D)	7, 11
vat-2	GTGACAACAGCTTCTGCAGC	vat(A)
vatB-1 vatB-2	GGCCCTGATCCAAATAGCAT GTGCTGACCAATCCCACCAT	U19459L38809, vat(B)	76–634	1 cycle of 3 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C; and 1 cycle of 10 min at 72°C	2, 11
vatC-O vatC-P	ATGAATTCGCAAAATCAGCAAGG TCGTCTCGAGCTCTAGGTCC	AF015628vat(C)	1307–1886	1 cycle of 3 min at 95°C and 2 min at 60°C; 30 cycles of 20 s at 72°C, 20 s at 95°C, and 20 s at 60°C; and 1 cycle of 1 min at 72°C	4
satA-1 satA-2	GCTCAATAGGACCAGGTGTA TCCAGCTAACATGTATGGCG	L12033vat(D)	361–632	1 cycle of 3 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C; and 1 cycle of 10 min at 72°C	11, 15
satG-1	ACTATACCTGACGCAAATGC	AF139725	66–577	1 cycle of 5 min at 94°C;	20
satG-2	GGTTCAAATCTTGGTCCG	vat(E)		30 cycles of 25 s at 94°C, 40 s at 52°C, and 50 s at 72°C; and 1 cycle of 6 min at 72°C
vga-1	AGTGGTGGTGAAGTAACACG	M90056	1149–1808	Same as for vat(D)	5, 11
vga-2	CTTGTCTCCTCCGCGAATAC	vga(A)
vgaB-1 vgaB-2	TGACAATATGAGTGGTGGTG GCGACCATGAAATTGCTCTC	U82085vga(B)	990–1566	1 cycle of 3 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C; and 1 cycle of 10 min at 72°C	3, 11
vgb-1	TACAGAGTACCCACTACCGA	M36022	781–1350	Same as for vga(B)	6, 11
vgb-2	TCAATTCCTGCTCCAGCAGT	vgb(A)
vgbB-Q	CAGCAGTCTAGATCAGAGTGG	AF015628	512–1240	Same as for vat(C)	4
vgbB-R	CATACGGATCCATCTTTTCC	vgb(B)
ermB-1 ermB-2	CATTTAACGACGAAACTGGC GGAACATCTGTGGTATGGCG	M11180 ermB-1	836–1260	1 cycle of 3 min at 94°C; 25 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C; and 1 cycle of 10 min at 72°C	13erm(B)
strep-M strep-N	ATHATGAAYGGIGCIAAYCAYMGIATG ICCDATCCAIACRTCRTTICC			1 cycle of 5 min at 95°C; 35 cycles of 2 min at 40°C, 90 s at 72°C, and 30 s at 95°C; and 1 cycle of 4 min at 40°C and 12 min at 72°C	14