Table 4.

Candidate variants potentially explaining the identified haplotype regions.

Haplotype	Gene	OMIM	Variant description
			Genomic positiona	Description	Transcriptb	Coding DNA change	Protein change
HH21c	NOTCH3	600276	chr7:7913459	3 bp deletion (inframe deletion)	XM_003586246.3	c.129_131delTTG	p.Cys44del
HH3d	SMC2e	605576	chr8:93753358	SNV (missense)	XM_015472668.2	c.3404T > C	p.Phe1135Ser
HH25	RIOX1	611919	chr10:84938370	30 bp deletion (inframe deletion)	NM_001099702.1	c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA	p.Ala133_Glu142del
HH13f	KIR2DS1	604952	chr18:62758881	SNV (nonsense)	NM_001097567.1	c.475C > T	p.Gln159*
HH35	PCDH15	605514	chr26:5325675	SNV (missense)	XM_015460562.2	c.2599C > G	p.Leu867Val

^aAccording to the reference sequence ARS-UCD1.2³¹.

^bAccording to NCBI Annotation Release 106⁹¹.

^cHaplotype described before as 175.5 and 07-126 by VanRaden et al. and Sahana et al., respectively^13,18.

^dHaplotype previously described by VanRaden et al., McClure et al., Sahana et al. and Wu et al.^13,18,19,87.

^eVariant previously detected by McClure et al.²⁴.

^fHaplotype previously described by Fritz et al.¹⁶.