Table 1.
miRNA sequence table
| Name | CKIP-1 3ʹUTR | (5’-3’) |
|---|---|---|
| rno-let-7d-5p | 76–82 /2882-2888 | AGAGGUAGUAGGUUGCAUAGUU |
| rno-mi R-129-5p | 86–92 | CUUUUUGCGGUCUGGGCUUGC |
| rno-mi R-98-5p | 76–82/2882-2888 | UGAGGUAGUAAGUUGUAUUGUU |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.