FIG. 2.
Structural analysis of Tn3872 in A. defectiva NEM1418. (A) The structures of Tn916 (7) and Tn917 (16) are shown, and their main orf genes are labelled as described. The black arrows at the extremities of Tn916 and Tn917 represent their terminal inverted repeats. The location and strand specificity of the PCR primers (O1 to O24) in both transposons are indicated by large black arrows. Positive PCR obtained by using the NEM1418 DNA template are depicted by a horizontal line which joins the primer pairs used, and the size (in kilobases) of the corresponding amplicon is indicated above the line. (B) Partial sequence analysis of the O13-O20 and O23-O14 amplicons. The nucleotide sequence of the 23-bp long left (IRL) and right (IRR) inverted repeat of Tn917 are boxed. The sequence corresponding to Tn916 orf9 is underlined by an arrow oriented according to the direction of transcription. The 5-bp duplications at the Tn917 insertion site are written in bold characters. The sequences (5′ to 3′) of the primers were as follows: O1, GGACTTATCACACTTTATCAAGG; O2, GCCTTGTAATACCAGTCG; O3, CCGTTTAGCTGTTGCGACTGG; O4, CGTAAGCATAACATTCCCCG; O5, GCAAGCTCAAAGCGGTTGCC; O6, CTGTTTACTATTGATGGTTTC; O7, TCAAACTGGACGCTGAAACG; O8, GAGCCAGCACTTCTGCGG; O9, ACAGGTGGAATCGGGCGG; O10, CCCGTCATTCACATAGTAGG; O11, GGTACTTGAAAAGAACGGGAG; O12, TCCATACATAACGGAAAGAGCC; O13, CGGCTCTTTCCGTTATGTATGG; O14, GATGTACTTCATGGCGACG; O15, GTACGTCCACCAATGTGG; O16, GCACGCTTCCACGAAAGGAG; O17, CTCTCCTTTCGTGGAAGCG; O18, GTACTACTAAGCAACAAGACGC; O19, GGTAAAGGGCATTTAACGAC; O20, CGATATTCTCGATTGACCCA; O21, CCAAGGAGCTAAAGAGGTCCC; O22, GTCCCGAGTCCCATGGAAGC; O23, GCTTCCATGGGACTCGGGAC; O24, GCTCCCAATTAATAGGAGA.