TABLE 1.
PCR primers for amplification and sequencing of the respective H. pylori and M. tuberculosis rpoB segments
| Sp. and region | Primer | Nucleotide sequence (5′ to 3′) | Position in the rpoB gene (bp) |
|---|---|---|---|
| H. pylori V149 | RpoB-ri 1a | CCCAACAGATTTAGAAGT | 54–71 (sense) |
| RpoB-ri-F | GATCCCTTTGATGACAGAAC | 387–406 (sense) | |
| RpoB-ri-Ra | TACCATAACAGGCTCAGC | 916–899 (antisense) | |
| Cluster I + II | RpoB-5 | AAATGATCACAAGCACCATC | 1530–1549 (sense) |
| RpoB-CL | ACCTTGCCATCCACAACC | 1839–1822 (antisense) | |
| RpoB-CLFa | ATGTGCCTGATTACATCACGAC | 1271–1292 (sense) | |
| RpoB-CLRa | TTGGCGCTGCATGTTAGTCC | 2106–2087 (antisense) | |
| M. tuberculosis V176 | Tb176-f | CTTCTCCGGGTCGATGTCGTTG | 294–315 (sense) |
| Tb176-R | CGCGCTTGTCGACGTCAAACTC | 658–637 (antisense) | |
| Cluster I + II | TbRif-1 | CAGACGTTGATCAACATCCG | 1243–1262 (sense) |
| TbRif-2 | TACGGCGTTTCGATGAAC | 1547–1530 (antisense) |
a
Primers for amplification of the large fragments used for transformation.