| Gene | Forward sequence (5′–3′) | Reverse sequence (5′–3′) |
|---|---|---|
| Human TFR1 | aggaaccgagtctccagtga | atcaactatgatcaccgagt |
| Human ACTB | gggaaatcgtgcgtgaca | ggactccatgcccagga |
| mTFR1 | tcctttccttgcatattctgg | ccaaataaggatagtctgcatcc |
| mMFRN2 | tgtgtggcgacattacttcat | gcatcctctgcttgacgact |
| mALAS2 | ctcaccgtctttggttcgtc | ggacaggaccgtagcaacat |
| mATRO1 | agtgaggaccggctactgtg | gatcaaacgcttgcgaatct |
| mMURF1 | tgacatctacaagcaggagtgc | tcgtcttcgtgttccttgc |
| mREDD1 | ccagagaagagggccttga | ccatccaggtatgaggagtctt |
| mCPT1B | aagagaccccgtagccatcat | gacccaaaacagtatcccaatca |
| mACOT1 | caactacgatgacctcccca | gagccattgatgaccacagc |
| mMCD | gcacgtccgggaaatgaac | gcctcacactcgctgatctt |
| mGAPDH | aggtcggtgtgaacggatttg | tgtagaccatgtagttgaggtca |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.