KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| rabbit anti-PTPRD | ABclonal | A15713 |
| Mouse anti-asprosin | This paper | N/A |
| mouse IgG | Southern Biotech | 0107-01 |
| Rabbit IgG | Southern Biotech | 0111-01 |
| mouse monoclonal anti-stat3 | Cell signaling technology | 9139 |
| rabbit monoclonal anti-phospho Stat3-Tyr705 | Cell signaling technology | 9145 |
| Mouse βActin | Cell signaling technology | 8H10D10 |
| HRP-conjugated anti-rabbit | GE Healthcare | NA934-1ML |
| HRP-conjugated anti-mouse | KPL Scientific | 474-1806 |
| anti-HA antibody | Covance | MMS-101P |
| mouse anti-his | Genscript | A00186 |
| Bacterial and virus strains | ||
| AAV-FLEX-saCas9 | Vector Biolabs | 7122 |
| AAV-Ptprd/sgRNA-FLEX-mCherry | This paper | N/A |
| Ad5-empty Adenovirus | Mishra et al., 2021 | N/A |
| Ad5-FBN1 virus Adenovirus | Mishra et al., 2021 | N/A |
| Ad5-IL2-Asprosin Adenovirus | Mishra et al., 2021 | N/A |
| Ad5-IL2-hPTPRD-LBD Adenovirus | This paper | N/A |
| Ad5-eGFP Adenovirus | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| GST-Asprosin | This paper | N/A |
| His-Asprosin | Biolegend | 761902 |
| PTPRD protein | Creative BioMart | PTPRD-36H |
| PTPRD protein | Acro Biosystems | PTD-H52H9 |
| Green Fluorescent Protein | United States Biological | G8965-10E |
| His-Tag Labeling Kit RED-tris-NTA | NanoTemper | SKU: MO-L018 |
| Protease III | ACDBio | 322337 |
| RNAScope probes for AgRP | ACDBio | 400711 |
| RNAScope probes for Olfr734 | ACDBio | 878653-C3 |
| RNAScope probes for Prprd | ACDBio | 474651-C2 |
| IP Lysis Buffer | ThermoFisher Scientific | 87787 |
| 1X Halt protease inhibitor cocktail | ThermoFisher Scientific | 87786 |
| Protein G magnetic beads | ThermoFisher Scientific | 88847 |
| Bolt LDS Sample Buffer | Fisher Scientific | B00008 |
| Bolt 4–12% Bis-Tris Plus gradient gel | Thermo Scientific | NW04122BOX |
| N-PER Neuronal protein extraction reagent | Thermo Fisher | 87792 |
| NuPAGE™ sample buffer | Fisher Scientific | NP0007 |
| NuPAGE™ 3 to 8%, Tris-Acetate gel | Thermo Scientific | EA03755BOX |
| chemiluminiscent substrates | Thermo Fisher Scientific | 34577 |
| chemiluminiscent substrates | Thermo Fisher Scientific | 34094 |
| Critical commercial assays | ||
| Mouse Asprosin ELISA kit | Amsbio | AMS.ELK6516 |
| Mouse Asprosin ELISA kit | Abbexa | Abx585287 |
| mouse/rat total Ghrelin ELISA kit | EMD Millipore | EZRGRT-91K |
| Phospho-Stat3 ELISA kit | Abcam | ab126458 |
| Experimental models: Cell lines | ||
| HEK293T | ATCC | CRL-3216 |
| Experimental models: Organisms/strains | ||
| C57BL/6J Mus musculus | Jackson Laboratory | JAX:000664 |
| ROSA26::FLPe knock in | Jackson Laboratory | JAX:003946 |
| C57BL/6-Agrptm1(cre)Lowl | Jackson Laboratory | JAX:012899 |
| B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J | Jackson Laboratory | JAX:007905 |
| B6J.129(Cg)-Rpl22tm1.1Psam/SjJ Mus musculus | Jackson Laboratory | JAX: 029977 |
| B6;129-Ptprdtm1Yiw/YiwRbrc Mus musculus | RIKEN BioResource | RBRC04925 |
| C57BL/6N-Atm1Brd Ptprdtm2a(KOMP)Wtsi/Mmucd | Wellcome Trust Sanger Institute | MMRRC_065397-UCD |
| Oligoneucleotides | ||
| Ptprd-Fwd: 5’tctgaggccaggaactgttt3’ | This paper | N/A |
| Ptprd-Rev: 5’tggaacccttttagagcttgc3’ | This paper | N/A |
| Gapdh-Fwd: 5’gggttcctataaatacggactgc3’ | This paper | N/A |
| Gapdh-Rev: 5’ccattttgtctacgggacga3’ | This paper | N/A |
| Olfr734-Fwd: 5’gcagggctatatccacttgttatt3’ | This paper | N/A |
| Olfr734-Rev: 5’gatggatggtccaaacattagc3’ | This paper | N/A |
| Npy-Fwd: 5’ccgctctgcgacactacat3’ | This paper | N/A |
| Npy-Rev: 5’tgtctcagggctggatctct3’ | This paper | N/A |
| AgRP-Fwd: 5’ttccaggctatataacaaaatctgtg3’ | This paper | N/A |
| AgRP-Rev: 5’tgtagccagggcatgagg3’ | This paper | N/A |
| GAPDH-Fwd: 5’gagtccactggcgtcttcac3’ | This paper | N/A |
| GAPDH-Rev: 5’gttcacacccatgacgaaca3’ | This paper | N/A |
| PTPRD-Fwd: 5’ctgtgacagcccatacagatg3’ | This paper | N/A |
| PTPRD-Rev: 5’gcgaggaggaccactagga3’ | This paper | N/A |
| PTPRD (for detection of PTPRD-LBD)-Fwd: 5’aatatgagtgtgttgccaccaa3’ | This paper | N/A |
| PTPRD (for detection of PTPRD-LBD)-Rev: 5’gacacggcgaacttctcg3’ | This paper | N/A |
| Ptprd sgRNA (gtcagcaaccagagatttga) | This paper | N/A |
| siGENOME Non-Targeting siRNA Pool #1, 5 nmol | Dharmacon | D-001206-13-20 |
| siGENOME Human PTPRD siRNA - SMARTpool | Dharmacon | M-008527-01-0010 |
| Recombinant DNA | ||
| 4xM67 pTATA-TK-Luc | Addgene | 8688 |
| pCMV-Asprosin | This Paper | N/A |
| pCMV-Empty | This Paper | N/A |
| Software and algorithms | ||
| Graphpad Prism version 6 & 7 | GraphPad | https://www.graphpad.com |
| R version 4.0.3 | R software | https://www.R-project.org/ |
| Other | ||
| DharmaFECT 1 Transfection Reagent | Dharmacon | T-2001-02 |
| RNeasy Mini Kit (250) | Qiagen | 74106 |
| Iscript™ cDNA Synthesis Kit | Bio-Rad | 1708891 |
| Itaq™ Universal Probes Supermix | Bio-Rad | 172-5131 |
| Ambion Single-Cell-to-CT Kit | Thermo Fisher Scientific | 44-582-37 |
| Reporter Lysis 5X Buffer | Promega | E3971 |
| Luciferase Assay Reagent | Promega | E1483 |
| FuGENE HD Transfection Reagent | Promega | E2311 |
| Teklad High Fat Diet | Envigo | TD.06414 |