Skip to main content
. 2022 Apr 8;11:e72723. doi: 10.7554/eLife.72723

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Japanese quail) Coturnix coturnix japonica Moshav Mata NCBI taxon: 93,934
Antibody anti-GFP (Rabbit polyclonal) Invitrogen, Thermo-Fisher Scientific Cat#A6455; RRID:AB_221570 IF(1:1000)
Antibody anti-GFP (Mouse monoclonal) Abcam Cat#Ab38689; RRID:AB_732715 IF(1:100)Not available anymore
Antibody anti-RFP (Rabbit polyclonal) Acris Cat# AP09229PU-N; RRID:AB_2035909 IF(1:1000)
Antibody anti-pSmad1/5/8 (guinea pig polyclonal) Ed Laufer N/A IF(1:300)
Antibody anti-pSmad1/5/9 (Rabbit monoclonal) Cell Signaling Technology Cat#CST13820; RRID:AB_2493181 IF(1:500)
Antibody anti-H3-pS10 (Mouse monoclonal) Abcam Cat#Ab14955; RRID:AB_443110 IF(1:400)
Antibody anti-Laminin (Rabbit polyclonal) Sigma, Israel Cat#L9393; RRID:AB_477163 IF(1:100)
Antibody anti-Sox9 (Rabbit polyclonal) Millipore Cat#AB5535; RRID:AB_2239761 IF(1:150)
Antibody anti-SNAI2 (Rabbit monoclonal) Cell Signaling Technology Cat#CST9585; RRID:AB_2239535 IF(1:500)
Antibody anti-CD57(HNK1) (Mouse monoclonal) BD Biosciences Cat#559048; RRID:AB_397184 IF(1:500)
Antibody anti-BarHL1 (Rabbit polyclonal) Sigma, Israel Cat# HPA004809; RRID:AB_1078266 IF(1:300)
Antibody anti-Pax7(Mouse monoclonal) DHSB Cat# pax7; RRID:AB_528428 IF(1:10)
Antibody anti-Hb9 (mouse monoclonal) DHSB Cat# 81.5C10; RRID:AB_2145209 IF(1:200)
Recombinant DNA reagent pCAGG(plasmid) Krispin et al., 2010b
Recombinant DNA reagent pCAGGS-EGFP(plasmid) Krispin et al., 2010b
Recombinant DNA reagent pCAG-mGFP(plasmid) Addgene RRID:Addgene_14757
Recombinant DNA reagent pCAGGS-RFP(plasmid) Ofek et al., 2021
Recombinant DNA reagent pCAGGS-RARα403(plasmid) This paper Subcloned as described in Methods section
Recombinant DNA reagent pCAGGS-Cyp26A1(plasmid) This paper Subcloned as described in Methods section
Recombinant DNA reagent pCAB-cSmad6(plasmid) Nitzan et al., 2016
Recombinant DNA reagent pCAG-VP16-RARα-IRES-eGFP(plasmid) Novitch et al., 2003
From S. Sockanathan
Recombinant DNA reagent pGL3-RARE-SV40-AP(plasmid) Gupta and Sen, 2015 From J. Sen
Recombinant DNA reagent pGL3-RARE-SV40-RFP(plasmid) This paper Subcloned as described in Methods section
Recombinant DNA reagent pGL3-RARE-SV40-d2EGFP (plasmid) This paper Subcloned as described in Methods section
Recombinant DNA reagent 12XTOPFLASH‐d2EGFP (plasmid) Rios et al., 2010
Recombinant DNA reagent cRaldh2 (plasmid) Diez del Corral et al., 2003 From K. StoreyTemplate for probe synthesis
Recombinant DNA reagent cBAMBI (plasmid) Casanova et al., 2012 EST 603482731F1 From A. Sanz-EzquerroTemplate for probe synthesis
Recombinant DNA reagent cCyp26A1 (plasmid) Wilson et al., 2007 From R. WingateTemplate for probe synthesis
Recombinant DNA reagent cHairy1 (plasmid) Jouve et al., 2000; Nitzan et al., 2016 From D. HenriqueTemplate for probe synthesis
Recombinant DNA reagent cfoxd3 (plasmid) Dottori et al., 2001 EST 603374321F1 From M. CheungTemplate for probe synthesis
Recombinant DNA reagent cRARα (plasmid) Diez del Corral et al., 2003 From K. StoreyTemplate for probe synthesis
Recombinant DNA reagent cRARβ (plasmid) Diez del Corral et al., 2003 From K. StoreyTemplate for probe synthesis
Recombinant DNA reagent cRARγ(plasmid) A.Graham Template for probe synthesis
Recombinant DNA reagent cRXRα (plasmid) A.Graham Template for probe synthesis
Recombinant DNA reagent cRXRγ (plasmid) A.Graham Template for probe synthesis
Sequence-based reagent qCyp1B1_F This paper PCR primers GTGTTGTGACTGCTGGGATG
Sequence-based reagent  qCyp1B1_R This paper PCR primers AGATTGACCAGTGAGCCAGG
Sequence-based reagent qsox9_F This paper PCR primers TCGAAGGAAACTGGCTGACC
Sequence-based reagent qsox9_R This paper PCR primers ATCAATGTGGGGAGGTTGGC
Sequence-based reagent qRspo1_F This paper PCR primers AAACCACCGGTCTCTGTGTC
Sequence-based reagent qRspo1_R This paper PCR primers AGCAGGAGGGAAGGAAGAAG
Sequence-based reagent qdraxin_F This paper PCR primers TGTGCTGGATGTGGTTGTTT
Sequence-based reagent qdraxin_R This paper PCR primers TGGTTTGCAGAGATGCTCAC
Sequence-based reagent qGrem1_F This paper PCR primers AGGCTGCTTTTGGAGAACAA
Sequence-based reagent qGrem1_R This paper PCR primers GAATGGGTTTTGGTTGATG
Sequence-based reagent qCRABP1_F This paper PCR primers ACCTGGAAGATGAGGAGCAG
Sequence-based reagent qCRABP1_R This paper PCR primers CACACGGTCACATACAACACC
Sequence-based reagent qNorrin(NDP)_F This paper PCR primers GCACTGTCCTAAAGCAGCCT
Sequence-based reagent qNorrin(NDP)_R This paper PCR primers TTCAGGCCCCGGGAGATATT
Sequence-based reagent qsnai2_F This paper PCR primers TGAGATACGGGGAAAGACGC
Sequence-based reagent qsnai2_R This paper PCR primers AGGCACTTGGAGGGGTAATG
Commercial assay or kit KAPA2G Fast ReadyMix PCR Sigma, Israel Cat#KK5101
Chemical compound, drug NBT Roche Cat#11383213001
Chemical compound, drug BCIP Sigma, Israel Cat#B8503
Chemical compound, drug Fast Red Sigma, Israel Cat#F4648
Software, algorithm FIJI Schindelin et al., 2009 https://imagej.net/software/fiji/
Software, algorithm R and R-Studio https://www.R-project.org; http://www.rstudio.com RRID:SCR_000432 R Version 4.0.3
Software, algorithm Adobe Photoshop and Indesign CS6 Adobe https://www.adobe.com/
Software, algorithm Graphpad Prism Graphpad https://www.graphpad.com RRID:SCR_002798 Version 7.0
Other BTX square wave electroporator BTX, San Diego, CA, USA Cat#45–0662
Other DP73 cooled CCD digital camera Olympus https://www.olympus-global.com/
Other BX51 microscope Olympus https://www.olympus-global.com/
Other Nikon Eclipse 90i microscope Nikon https://www.nikon.com/
Other D-Eclipse c1 confocal system Nikon https://www.nikon.com/
Other DIG RNA mix Roche Cat#11277073910
Other anti-digoxigenin-AP Roche Cat#11093274910
Other Hoechst 33,258 stain Sigma, Israel Cat#14,530 (125 ng/ml)