Table 1.

Standard and diagnostic 12S rRNA PCR protocol for R. sanguineus s.l. lineage detection.

Primers		Reagent	Volume	Thermocycler Steps
				Cycle	Time
Standard 12S rRNA	Forward: AAACTAGGATTAGATACCCTATTATTTTAG Reverse: CTATGTAAGCACTTA- TCTTAATAAAGAGTG	PCR Water	25-sum of other reagents	Initial denaturation	95 °C for 30 s
		ThermoPol Buffer (New England BioLabs)	2.5	30 cycles:
		10 mM dNTPs	0.5	Denaturation	95 °C for 15 s
		10 µM FWD Primer	0.5	Annealing	50 °C for 30 s
		10 µM REV Primer	0.5	Extension	68 °C for 60 s
		Taq (New England BioLabs)	0.125	Final extension	68 °C for 60 s
		DNA	3.0	Holding	10°C
Temperate 12S rRNA	Forward: TTTTAGAGGTAAACA- TTGTT Reverse: GCTTAATTCAAATTGA- CATT	PCR Water	10-sum of other reagents	Initial denaturation	95 °C for 30 s
		ThermoPol Buffer (New England BioLabs)	1.0	25 cycles:
		10 mM dNTPs	0.8	Denaturation	95 °C for 15 s
		10 µM FWD Primer	0.5	Annealing	46 °C for 30 s
		10 µM REV Primer	0.5	Extension	68 °C for 60 s
		Taq (New England BioLabs)	0.1	Final extension	68 °C for 60 s
		DNA	1.0	Holding	10 °C
Tropical 12S rRNA	Forward: TTTTAGAGCTTAACAT- TGTA Reverse: GCTTAATTCAAATTAA- CATC	PCR Water	10-sum of other reagents	Initial denaturation	95 °C for 30 s
		ThermoPol Buffer (New England BioLabs)	1.0	25 cycles:
		10 mM dNTPs	0.8	Denaturation	95 °C for 15 s
		10 µM FWD Primer	0.5	Annealing	46 °C for 30 s
		10 µM REV Primer	0.5	Extension	68 °C for 60 s
		Taq (New England BioLabs)	0.1	Final extension	68 °C for 60 s
		DNA	1.0	Holding	10 °C