TABLE 3.

HRP labeled oligonucleotide probes used in this study^a

Probe name	Probe sequence (5′–3′)	Position	Target group	FA concn(%)b	Reference
EUB338 Ic	GCTGCCTCCCGTAGGAGT	338–355	Most Bacteria	35	73
EUB338 IIc	GCAGCCACCCGTAGGTGT	338–355	Planctomycetales	35	74
EUB338 IIIc	GCTGCCACCCGTAGGTGT	338–355	Verrucomicrobiales	35	74
ARCH-915	GTGCTCCCCCGCCAATTCCT	915–934	Archaea	35	75
OP3-565	TACCTGCCCTTTACACCC	608–626d	Candidate OP3 LiM	30	19

^aAlternatively, ARCH-915 was labeled with carboxyfluorescein at the bases shown in italics: GUG CTC CCC CGC CAA TTC CT.

^bFormamide (FA) concentration in the hybridization buffer.

^cUsed in a mix.

^dOP3 LiM 16S rRNA location.