REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-mouse IgG	Southern Biotec	Cat #1030-05; RRID: AB_2619742
anti-hamster-IgG(H+L)-HRP	Southern Biotech	Cat#6061-05; RRID: AB_2796135
SARS2-2	Diamond Laboratory	N/A
SARS2-71	Diamond Laboratory	N/A
SARS2-11	Diamond Laboratory	N/A
SARS2-16	Diamond Laboratory	N/A
SARS2-31	Diamond Laboratory	N/A
SARS2-38	Diamond Laboratory	N/A
SARS2-57	Diamond Laboratory	N/A
anti-mouse IgG	Sigma	Cat # A8924; RRID: AB_258426
Bacterial and virus strains
SARS-CoV-2 (strain 2019 n-CoV/USA_WA1/2020)	CDC/BEI Resources	Cat#NR52281
SARS-CoV-2 (strain hCoV-19/USA/WI-UW-4340/2021)	This paper (Kawoaka Laboratory)	N/A
SARS-CoV-2 N501Y/D614G	Pei-Yong Shi Laboratory	N/A
Chemicals, peptides, and recombinant proteins
Recombinant Spike protein of SARS-CoV-2	Hassan et al35	N/A
TMB substrate	Vector laboratories	Cat#SK4400
Critical commercial assays
RNA isolation kit	Omega Bio-Tek	Cat#R6834-01
TaqMan™ RNA-to-CT 1-Step Kit	Thermo Scientific	Cat#4352042
MagMAX MirVana Total RNA isolation kit	Applied Biosystems	A27828
Experimental models: Cell lines
Vero-hTMPRSS2	Chen et al6	N/A
Vero-hACE2-hTMPRSS2	Chen et al6	N/A
Experimental models: Organisms/strains
LVG Golden Syrian Hamster	Charles Rivers Laboratories	Crl:LVG(SYR)
K18-hACE2 transgenic mice	Jackson Laboratories	Cat # 34860
129S2/SvPasCrl	Charles Rivers Laboratories	Cat # 287
Oligonucleotides
SARS-CoV-2 N F: 5′-GACCCCAAAATCAGCGAAAT-3′	Integrated DNA technologies	N/A
SARS-CoV-2 N R: 5′-TCTGGTTACTGCCAGTTGAATCTG-3′	Integrated DNA technologies	N/A
SARS-CoV-2 N Probe: 5'-/56-FAM/ACCCCGCATTACGTTTGGTGGACC/3IABkFQ/-3′	Integrated DNA technologies	N/A
SARS-CoV-2 N F: 5′-ATGCTGCAATCGTGCTACAA-3′	Integrated DNA technologies	N/A
SARS-CoV-2 N R: 5′-GACTGCCGCCTCTGCTC-3′	Integrated DNA technologies	N/A
SARS-CoV-2 N Probe: 5'-/56-FAM/TCAAGGAACAACATTGCCAA/3IABkFQ/-3′	Integrated DNA technologies	N/A
Software and algorithms
GraphPad Prism	GraphPad	v9.3 (www.graphpad.com)
Nanozoomer Digital Pathology	Hamamatsu	v2 (https://www.hamamatsu.com/us/en/product/type/U12388-01/index.html)
BioSpot analyzer	Cellular Technology Limited	N/A
AxioImager Z2 system	Zeiss	N/A