Skip to main content
PLOS One logoLink to PLOS One
. 2022 Apr 20;17(4):e0266268. doi: 10.1371/journal.pone.0266268

Effectiveness of blocking primers and a peptide nucleic acid (PNA) clamp for 18S metabarcoding dietary analysis of herbivorous fish

Chiho Homma 1, Daiki Inokuchi 2, Yohei Nakamura 2, Wilfredo H Uy 3, Kouhei Ohnishi 1,2, Haruo Yamaguchi 1,2, Masao Adachi 1,2,*
Editor: Ram Kumar4
PMCID: PMC9020718  PMID: 35442965

Abstract

The structure of food webs and carbon flow in aquatic ecosystems can be better understood by studying contributing factors such as the diets of herbivorous fish. Metabarcoding using a high-throughput sequencer has recently been used to clarify prey organisms of various fish except herbivorous fish. Since sequences of predator fish have dominated in sequences obtained by metabarcoding, we investigated a method for suppressing the amplification of fish DNA by using a blocking primer or peptide nucleic acid (PNA) clamp to determine the prey organisms of herbivorous fish. We designed three blocking primers and one PNA clamp that anneal to fish-specific sequences and examined how efficient they were in suppressing DNA amplification in various herbivorous fish. The results showed that the PNA clamp completely suppressed fish DNA amplification, and one of the blocking primers suppressed fish DNA amplification but less efficiently than the PNA clamp. Finally, we conducted metabarcoding using mock community samples as templates to determine whether the blocking primer or the PNA clamp was effective in suppressing fish DNA amplification. The results showed that the PNA clamp suppressed 99.3%–99.9% of fish DNA amplification, whereas the blocking primer suppressed 3.3%–32.9%. Therefore, we propose the application of the PNA clamp for clarifying the prey organisms and food preferences of various herbivorous fish.

Introduction

Herbivorous fish play an important role in determining the biological structure of shallow-water environments and carbon flow in aquatic ecosystems [1, 2]. The decline in abundance of herbivorous fish in tropical coral reefs causes a phase shift from coral- to algal-dominated reefs [3, 4], whereas an increase in fish herbivory in temperate reefs leads to a shift from algal forests to deforested barrens [5, 6]. Selective feeding by herbivorous fish affects algae and benthic-invertebrate species composition [7, 8]. A meta-analysis on the fate of photosynthetic carbon in marine ecosystems estimates that 30%–40% of the micro- and macroalgae net primary production of photosynthetic carbon is channeled to heterotrophs through herbivory [9]. Therefore, the structure of food webs and the functional roles of herbivorous fish in aquatic ecosystems can be elucidated by assessing the food preferences and diets of herbivorous fish.

Several methods have been used to investigate the food habits of herbivorous fish: multiple-choice experiments [10, 11], direct feeding observations [12], stable isotope ratio analysis [13], and stomach/gut content analysis [1416]. Multiple-choice experiments and direct feeding observations are practical for large and browsing herbivorous fish that feed on macroalgae but not for small or grazing herbivorous fish that feed on microalgae. Stable isotope analysis provides information on taxonomic groups of prey but is not applicable for identifying the prey species. Stomach content analysis has been the most widely used method, but the fragmentation of prey makes detailed taxonomical identification difficult [17], especially in herbivorous fish with pharyngeal teeth such as parrotfish [15]. DNA barcoding of organisms in the gut contents of Siganus fuscescens [18] and barcoding on the feeding substrates of Scarus ovifrons [19] have been conducted to determine the prey organisms of herbivorous fish. The DNA barcoding [18, 19] accompanied by single-stranded conformational polymorphism (SSCP) analysis or molecular cloning of PCR products circumvents the problem described above, but these approaches need DNA sequencing of many PCR products from the SSCP analysis or DNA sequencing of many clones derived from the PCR products, which are laborious and time-consuming [20].

Recently, the prey organisms of various carnivores in Perciformes, Squamata, and Passeriformes have been clarified via metabarcoding using a high-throughput sequencer (HTS) and universal primers for various eukaryotic organisms [21], but the method has not been applied to determine the prey organisms of herbivorous fish. Since universal primers in metabarcoding analysis sometimes amplify sequences derived from the predators as well as their prey organisms [22], it is critical to suppress the polymerase chain reaction (PCR) amplification of predator DNA in the analysis. Blocking primers and peptide nucleic acid (PNA) clamps have been used to suppress the DNA amplification of various predators [23]. Blocking primers are modified primers with an added C3 spacer at the 3′ end, which suppresses DNA amplification in PCR. Vestheim and Jarman [24] reported the development of blocking primers that bind specifically to suppress the sequence of krill (Euphausia superb), thus revealing the prey. Furthermore, blocking primers have been applied in metabarcoding to clarify the prey organisms of various fish [2532], however they have not been applied to herbivorous fish.

PNAs are synthetic nucleic acids of nucleo-bases that are linked to a peptide backbone [33]. When they bind to complementary DNA, they inhibit polymerase elongation and PCR amplification [34]. PNA clamps have also been applied to metabarcoding to clarify fish diet [35, 36], although there have been fewer reports on PNA clamps than on blocking primers. Terahara et al. [37] developed PNA clamps that specifically bind to Japanese eel (Anguilla japonica) sequences and reported that they successfully suppressed the DNA amplification of predatory fish and identified their prey organisms. However, whether blocking primers or PNA clamps are suitable than blockers for metabarcoding fish prey organisms has not been examined.

In this study, to apply the blockers to metabarcoding to clarify the gut contents of herbivorous fish, we investigated designing blockers that bind specifically to fish. The optimal annealing temperature and concentration of blockers for suppressing the PCR amplification of fish DNA were determined. Next, we conducted metabarcoding using mock community samples as templates and determined whether the blocking primer or the PNA clamp was effective in suppressing fish DNA amplification and clarifying the gut contents of herbivorous fish.

Materials and methods

Ethic statement

Although experiments on fish do not require any legal procedures or permission in Japan, in order to avoid causing pain to the specimens, we followed all applicable institutional and/or national guidelines for the care and use of animals (mammals, birds, and reptiles) in this study; i.e., Act on Welfare and Management of Animals (Notice of the Ministry of the Environment No. 105 of October 1, 1973), Standards relating to the Care and Keeping and Reducing Pain of Laboratory Animals (Notice of the Ministry of the Environment No. 88 of 2006), Fundamental Guidelines for Proper Conduct of Animal Experiment and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education (Notice of Ministry of Education No. 71, 2006), and Guidelines for Proper Conduct of Animal Experiments (established by the Science Council of Japan on June 1, 2006). Fish specimens in the Philippines were collected under the Gratuitous Permit no. 0148–18 issued by the Department of Agriculture-Bureau of Fisheries and Aquatic Resources and the auspices of the research collaboration between Mindanao State University and Kochi University. No special collection permit is required for Japanese fish samples because they are not regulated or endangered species. Samples from Muroto and Kutsu were obtained from fishermen, and those from Yokonami were collected at the water in front of the Yokonami Rinkai Experimental Station (Kochi University). We got verbal consent of all participants in this study.

Fish samples

Samples of 24 species from various taxonomic groups (4 orders, 9 families, and 19 genera) were collected to investigate the applicability of blockers to marine and freshwater herbivorous fish (S1 Table). Fish samples were collected by bait fishing, spear fishing, seine net, and hand net. Details of sampling are described in S1 Table. No endangered or protected species were involved in the field of sampling. Fish samples collected by spear fishing or bait fishing were euthanized by rapid severance of the head from the spinal at the time of sampling. Small fishes were euthanized by rapid chilling using ice-chilled water. The fish samples were sent to the Laboratory of Aquatic Environmental Science (Kochi University), where the species were identified by morphological characters [38] and then frozen at −25°C. Herbivory generally involves a fish diet consisting of at least 25%−50% plants [39]. Thus, not all species in this study were strictly herbivorous; some were like omnivorous (Cyprinus carpio, Pomacentrus coelestis), or possibly target protein-rich autotrophic microorganisms (parrotfish) [40]. Dietary information was obtained from Froese and Pauly [41] and published dietary data [42, 43].

Designing a universal reverse primer and blockers

To develop blocking primers and a PNA clamp that anneal to a partially overlapped region with the 3′ end of a eukaryotic-universal primer (Fig 1), we designed a new universal reverse primer that binds to a universal region among various eukaryotes and is adjacent to the fish-specific sequence (Fig 1). Multiple alignments were prepared using the 226 sequences of the 18S rDNA V8–V9 region of Teleostei, the 2,713 sequences of the 18S rDNA region of various taxa of eukaryotes (S2 Table), which were obtained from the National Center Biotechnology Information (NCBI), and the 24 fish sequences determined in this study described later using Geneious 104 11.1.5 (Biomatters, Auckland, New Zealand). The universal reverse primer, 18SV9R, which binds to all eukaryotic sequences of the 18S rDNA V9 region tested, was newly designed (Table 1, Fig 1, and S2 Fig) and used in combination with the eukaryote universal primer, V8f [44] which binds to the 18S rDNA V8 region. The blocking primer and PNA clamp were designed in a region that overlap with 18SV9R and specific to Teleostei (S2 Fig).

Fig 1. Binding site of each blocking primer and PNA clamp used in this study.

Fig 1

The arrow indicates the binding site of the universal reverse primer, 18SV9R. The bars indicate the blocking primers or PNA clamp. *: Base position based on the 18S rDNA sequence of Verasper variegatus (Acc. No. EF126043).

Table 1. List of the primers and the PNA clamp used in this study for metabarcoding.

Name Primer/PNA Direction Sequence (5’–3’)*1 Binding site*2 Length Tm*3 Reference
V8f Primer Forward ATAACAGGTCTGTGATGCCCT 1,487–1,507 21 58.8 [44]
18SV9R Primer Reverse CCTTGTTACGACTTYTMCTTCCTCTA 1,814–1,839 26 58.6–61.5 This study
V8f_tag Primer Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATAACAGGTCTGTGATGCCCT 1,487–1,507 21 58.8 [44]
18SV9R_tag Primer Reverse GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCTTGTTACGACTTYTMCTTCCTCTA 1,814–1,839 26 58.6–61.5 This study
BlockFish5 Primer Reverse CTCTAGATAGTCAAGTTTGATCG 1,796–1,818 23 54.2 This study
BlockFish10 Primer Reverse ACTTCCTCTAGATAGTCAAGTTTGATCG 1,796–1,823 28 60.4 This study
BlockFish_long6 Primer Reverse CCTCTAGATAGTCAAGTTTGATCGTCTTCTCGGC 1,786–1,819 34 67.4 This study
BlockFishPNA PNA Reverse CTCTAGATAGTCAAGTTTGATCG 1,796–1,818 23 77.5 This study

*1: Underline: overhang adapter sequence

*2: Base position based on the 18S rDNA sequence of Verasper variegatus (Acc. No. EF126043)

*3: Tm calculated using the nearest neighbor method

To suppress PCR amplification of fish-derived 18S rDNA, we developed three blocking primers and one PNA clamp target fish-specific sequences of the 18S rDNA V8–V9 region, namely, BlockFish5, BlockFishPNA, BlockFish_long6, and BlockFish10 (Table 1), thereby annealing to a partially overlapped region with 5, 5, 6, and 10 bp of the universal reverse primer 18SV9R, respectively (Fig 1).

Preparation of fish genomic DNA, PCR condition, and DNA sequencing

The dorsal fins or dorsal muscles of the fish samples were cut into sections (approximately 0.1 g each), which were transferred into separate 1.5 ml microcentrifuge tubes (Greiner Bio-One, Kremsmünster, Austria). The genomic DNA of the fish samples was extracted using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The concentration of genomic DNA of each sample was quantified using a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The 18S ribosomal RNA gene V8–V9 region of the fish samples was amplified by PCR using universal primer V8f [44] (Table 1) and 18SV9R (Table 1). The PCR mixture was as follows: 18.56 μl water for injection (Nipro Pharma, Osaka, Japan), 1 μl genomic DNA of each fish (10 ng/μl), 2.5 μl of 10 × Ex Taq buffer (TaKaRa Bio, Shiga, Japan), 2.0 μl 2.5 mM dNTPmix (dATP, dTTP, dGTP, dCTP), 0.13 μl TaKaRa Ex Taq (5 units/μl; TaKaRa Bio), and 0.4 μl of each primer (12.5 μM) as described above. The PCR consisted of 30 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 1 min, then one cycle of 72°C for 7 min. The PCR products were electrophoresed with ExcelBand 100 bp +3K DNA Ladder (SMOBiO Technology, Hsinchu, Taiwan) using 1.5% (w/v) agarose gel stained with ethidium bromide and viewed under an ultraviolet light [45]. Following the method of Hartley and Bowen [46], the products were purified to remove excess primers and dNTPs using 30% (w/v) polyethylene glycol (PEG) solution. Direct sequencing of the product to determine the 18S rDNA sequence of each fish sample was performed by using the primer V8f or 18SV9R with a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems Japan, Tokyo, Japan) following the manufacturer’s protocol.

Selection of blockers for suppressing PCR amplification of fish DNA

The usefulness of the blocking primers and the PNA clamp were evaluated by carrying out PCR in a total volume of 25 μl containing 22.5 μl of Platinum PCR SuperMix High Fidelity (Thermo Fisher Scientific), 0.2 μM of universal primers, 2.0 μM of BlockFish5, BlockFish10, BlockFish_long6, or BlockFishPNA, and 10 ng of genomic DNA of the herbivorous fish Scarus ovifrons (accession number of 18S rDNA: LC639933) as a template. As a control, sterile milli-Q water was added instead of the blocking primer or PNA clamp. PCR consisted of 30 cycles: denaturation at 94°C for 15 s, annealing at 60°C, 65°C, and 66°C for 30 s, and elongation at 68°C for 1 min. To evaluate the blocking efficiency of each blocking primer and the PNA clamp, amplicons with or without the blocking primer or PNA clamp were run by gel electrophoresis with ExcelBand 100 bp +3K DNA Ladder (SMOBiO Technology) using 1.5% (w/v) agarose gel stained with ethidium bromide, which was viewed under an ultraviolet light. Photographs were taken with a camera (PowerShot G1 X Mark Ⅱ, PC2049; Canon Inc., Tokyo, Japan), and the density of the bands was measured using ImageJ ver. 1.52i (National Institutes of Health, MD, USA). The relative amount of amplicon was calculated as follows:

Relativeamountofamplicon(%)=[(xa)/(ya)]×100

where x represents the band density of amplicon obtained by PCR with the blocking primer or PNA clamp; y represents the band density of amplicon obtained by PCR without any blocker; and a represents the background of the negative control obtained by PCR with sterilized milli-Q water instead of the template DNA.

Blocker suppression of fish DNA amplification was evaluated by the Tukey–Kramer test using R ver. 3.5.1.

Optimization of PCR conditions for suppressing fish DNA amplification

To clarify the optimal concentration of the blocking primer and PNA clamp required for suppressing PCR amplification of fish DNA, the18S rDNA V8–V9 region was amplified with 0.2 μM of V8f and 18SV9R primers and various concentrations (0.2 μM, 1.0 μM, and 2.0 μM) of BlockFish_long6 and BlockFishPNA using Scarus ovifrons DNA as a template at annealing temperatures of 60°C and 65°C, respectively. The amplicons were run by gel electrophoresis, and the density of the bands was measured using the method described above and then compared using the Tukey–Kramer test.

Applicability of the blocking primer and PNA clamp to various herbivorous fish

To investigate the applicability of BlockFish_long6 and BlockFishPNA to various herbivorous fish species, PCR was performed using the genomic DNA of 24 herbivorous fish (S1 Table) as templates. PCR was performed under optimal conditions to suppress the amplification of the S. ovifrons sequence as described above. BlockFish_long6 (2.0 μM) was added at an annealing temperature of 65°C. BlockFishPNA (0.2 μM) was added at an annealing temperature of 60°C. The amplicons were run by gel electrophoresis, and the density of the bands was measured using the method described above. The relative amount of amplicon was calculated as follows:

Relativeamountofampliconwithoutblocker(%)=[(xa)/(ya)]×100

where x represents the band density of amplicon obtained by PCR without the blocking primer or PNA clamp; y represents the band density of the 500 bp band of the 100 bp ladder marker; and a represents the background of the negative control obtained by PCR with sterilized milli-Q water instead of the template DNA.

Relativeamountofampliconwithblocker(%)=[(xa)/(ya)]×100

where x represents the band density of the amplicon obtained by PCR with the blocking primer or PNA clamp; y represents the band density of amplicon obtained by PCR without any blocker; and a represents the background of the negative control obtained by PCR with sterilized milli-Q water instead of the template DNA.

To evaluate the suppression of fish DNA amplification by using blockers, the Tukey–Kramer test was performed using R ver. 3.5.1.

Mock community preparation and sequencing

To assess the efficiency of the blockers to suppress DNA amplification, three artificial samples of mock communities were prepared (Table 2). Eight organisms were selected to represent a wide range of genetically distinct eukaryotic taxa, as shown in Table 2. The three mock community samples selected were the fish Scarus ovifrons, three taxa of macroalgae, one taxon of microalgae, and three taxa of marine benthic animals. Each organism was identified based on the morphological characteristics and phylogenetic position, which was analyzed with the 18S rDNA sequences determined by the method described below.

Table 2. Details of the experimental design and the organisms used to create the three mock community samples (Mock1–3) used for the metabarcoding.

Organism Taxon Location Date Acc. No. of 18S rDNA Mock1*1 Mock2*1 Mock3*1
Scarus ovifrons Teleostei Muroto Misaki, Muroto City, Kochi, Japan (33.266, 134.160) 2015. 07. 13 LC639933 1 10 100
Zonaria diesingiana Ochrophyta Otsuki, Hata, Kochi, Japan (32.463, 132.433) 2019. 08. 27 LC639948 1 1 1
Gelidium sp. Rhodophyta Otsuki, Hata, Kochi, Japan (32.463, 132.433) 2019. 08. 27 LC639950 1 1 1
Ulva reticulata Chlorophyta Otsuki, Hata, Kochi, Japan (32.463, 132.433) 2019. 08. 27 LC639946 1 1 1
Symbiodinium sp. Dinoflagellata Pet shop*2 2019. 11. 13 LC639945 1 1 1
Pagurus filholi Arthropoda Tei, Konan City, Kochi, Japan (33.311, 133.451) 2019. 10. 04 LC639951 1 1 1
Nereididae sp. Annelida Tei, Konan, City, Kochi, Japan (33.311, 133.451) 2019. 10. 04 LC639947 1 1 1
Euphylliidae sp. Cnidaria Pet shop*1 2019. 11. 13 LC639949 1 1 1

*1: Number in column showed a ratio of each organism in the mock community samples.

*2: Symbiodinium sp. DNA was obtained from a Euphylliidae sp. purchased from a pet shop located in Kochi City, Kochi, Japan.

The genomic DNA sequences of eight mock sample organisms were extracted using a PowerSoil® DNA Isolation Kit (Qiagen) according to the manufacturer’s protocol. The amount of DNA in each sample was quantified using the Qubit® 3.0 Fluorometer (Thermo Fisher Scientific) according to the manufacturer’s protocol. The 18S rDNA V8–V9 region of the eight organisms was amplified with V8f [44] and 18SV9R (Table 1) primers using the genomic DNA as templates under the conditions described above. PCR products were purified using a NucleoSpin PCR Clean-up Gel Extraction Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. Purified PCR products were cloned into the T vector pMD20 (TaKaRa Bio) according to the manufacturer’s protocol. The vectors were introduced into Escherichia coli using a NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, MA, USA) following the manufacturer’s protocol. The plasmids were extracted from the transformed bacteria using the Fast Gene Plasmid Mini Kit (Nippon Genetics, Tokyo, Japan). After extraction, the 18S rDNA sequence that was inserted into the vectors was determined using the primer V8f with a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems Japan) following the manufacturer’s protocol.

Plasmid DNA (10 μg) containing the 18S rDNA V8–V9 region of each organism was digested with 180 units of HindⅢ (18 units/μl; Toyobo, Osaka, Japan) according to the manufacturer’s protocol. The digested plasmid DNA was purified using a NucleoSpin PCR Clean-up Gel Extraction Kit (Macherey-Nagel), following the manufacturer’s protocol. The concentration of the digested plasmids was quantified using a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific) following the manufacturer’s protocol. The purified plasmids were mixed in the ratios shown in Table 2.

To evaluate the suppression of fish 18S rDNA amplification with blockers during metabarcoding, the 18S rDNA V8–V9 region was duplicately amplified via PCR with V8f_tag and 18SV9R_tag (Table 1) and the blocker using the mock community samples as templates (Table 3) under the condition described above. DNA amplification in the two samples was determined by gel electrophoresis. Duplicate PCR amplicons were combined and purified using AMPure XP beads (Beckman Coulter, CA, USA) following the manufacturer’s instructions. Next, Dual-Index PCR to add the index to the amplicons was performed according to the “16S Metagenomic Sequencing Library Preparation” protocol (Illumina, CA, USA) using the Nextera® XT Index Kit v2 Set A (Illumina). The PCR products were purified using AMPure XP beads (Beckman Coulter). The amount of DNA in each sample was quantified using a Qubit® 3.0 Fluorometer (Thermo Fisher Scientific) according to the manufacturer’s protocol. The purified amplicons were diluted to 4 nM with 10 mM Tris-HCl (pH 8.5). The diluted amplicons of 24 samples were mixed in a single 1.5 ml tube. The mixture (5 μl) was subjected to MiSeq Reagent Nano Kit v2 (2 × 250 pair end; llumina) on an in-house MiSeq platform (Illumina).

Table 3. Samples used for evaluating the suppression of fish 18S rDNA amplification with and without blockers using the mock community samples as templates.

Sample No. Blocker Annealing temp. (°C) Template*1
1 - 65 Mock1
2 - 65 Mock2
3 - 65 Mock3
4 BlockFish_long6 65 Mock1
5 BlockFish_long6 65 Mock2
6 BlockFish_long6 65 Mock3
7 - 60 Mock1
8 - 60 Mock2
9 - 60 Mock3
10 BlockFishPNA 60 Mock1
11 BlockFishPNA 60 Mock2
12 BlockFishPNA 60 Mock3

*1: Mock samples described in Table 2.

Processing and analysis of data

Sequence data obtained by MiSeq were used to make pair–end sequences in Mothur ver. 1.36.0 [47] on Galaxy 1.39.5.0 (URL: https://usegalaxy.org/). Paired‐end reads were processed using Mothur v.1.33.0. Primer sequences were removed (pdiffs = 3), and no ambiguous bases were allowed. The maximum homopolymer size was 8 bp, and short sequences below 270 bp were removed. The remaining sequences were de‐replicated and screened for chimeras using UCHIME [48]. Reads were clustered into operational taxonomic units (OTU) using preclustering with 98% similarly. BLAST was conducted using NCBI local blast + ver. 2.7.1 with 90% similarity.

Suppression of fish DNA amplification was calculated as follows:

Suppression(%)=(b/c)×100

where b represents the proportion of reads of fish (Teleostei) to the total reads obtained for each sample with the blocker; and c represents the proportion of reads of fish (Teleostei) to the total reads obtained for each sample without the blocker.

Results

Selection of blockers and optimization of PCR conditions for suppressing fish DNA amplification

To select blockers that are useful for suppressing fish DNA amplification, PCR was performed at annealing temperatures of 60°C, 65°C, and 66°C using four blockers targeting the 18S rDNA V9 region (Table 1, Fig 1). The results showed that the relative amount of amplicons with BlockFish5 and BlockFish10 at the annealing temperatures of 60°C and 65°C were not significantly different from those that did not use blockers as the controls (Fig 2A and 2B). BlockFish5 and BlockFish10 significantly reduced the relative amount of amplicons by approximately 50% from that of control at 66°C (Fig 2C, Tukey–Kramer test: p < 0.01). BlockFish_long6 significantly reduced the relative amount of amplicons by 7.8% and 23.7% from those of the controls at 65°C and 66°C, respectively (Tukey–Kramer test: p < 0.01), whereas the blocker did not significantly reduce the relative amount of amplicons at 60°C (Fig 2). In contrast to these blocking primers, BlockFishPNA reduced the relative amount of amplicons by 100% from those of the controls at all the temperatures tested (Fig 2, Tukey–Kramer test: p < 0.01). When PCR was conducted without any blocker, the amount of amplicons obtained at the annealing temperature of 66°C was significantly lower than that at 60°C (S1 Fig, Tukey–Kramer test: p < 0.01). BlockFish_long6 and BlockFishPNA were further investigated at the annealing temperatures of 65°C and 60°C, respectively.

Fig 2. Suppression of fish 18S rDNA amplification with the blocking primers and PNA clamp.

Fig 2

Annealing temperatures: A: 60°C; B: 65°C; C: 66°C. Control: 18S rDNA amplification without the blocking primer or PNA clamp. a: Tukey–Kramer test: p < 0.01. *: Relative amount of amplicon when the amount of amplicon of the control was considered to be 100%.

The concentrations of the blocking primer and the PNA clamp that are suitable for suppressing fish DNA amplification were evaluated via PCR conducted with various concentrations (0.2 μM, 1.0 μM, and 2.0 μM) of BlockFish_long6 and BlockFishPNA. The results showed that the higher the concentration of BlockFish_long6, the lower the relative amount of amplicons (Fig 3A, Tukey–Kramer test: p < 0.01). BlockFishPNA showed 100% suppression of fish DNA amplification at all concentrations tested (Fig 3B). Considering these results, 2.0 μM (10 times the concentration of universal primers) of BlockFish_long6 and 0.2 μM (the same concentration as that of the universal primers) of BlockFishPNA were further investigated.

Fig 3. Effect of the concentration of the blocking primer or PNA clamp in a PCR cocktail on the suppression of fish 18S rDNA amplification.

Fig 3

A: BlockFish_long6 added; B: BlockFishPNA added. Tests 1, 4: 0.2 μM added; Tests 2, 5: 1.0 μM added; Tests 3, 6: 2.0 μM added. Control: 18S rDNA amplification without the blocking primer or PNA clamp. a: Tukey–Kramer test: p < 0.01. *: Relative amount of amplicon when the amount of amplicon of the control was considered to be 100%.

Applicability of the blockers to various herbivorous fish

To investigate the applicability of BlockFish_long6 and BlockFishPNA to various herbivorous fish species, PCR was performed using blockers with the genomic DNA of 24 herbivorous fish (S1 Table) employed as templates. When BlockFish_long6 was used, the relative amount of amplicon was 0% for Cyprinus carpio, Carassius auratus langsdorfii, and Chlorurus bleekeri, i.e., the suppression efficiency was 100%; the relative amount of amplicon was < 50% for the 16 fish species showing ≧50% suppression efficiency; and the relative amount of amplicon was ≧50% for four species showing suppression efficiency of less than 50% (Table 4). In using the genomic DNA of Naso vlamingii as the template, 18S rDNA was not amplified at the annealing temperature of 65°C, even when the blocking primer was not added (Table 4). In contrast, BlockFishPNA effectively suppressed amplification of all tested fish DNA (Table 4).

Table 4. PCR amplification of herbivorous fish 18S rDNA and suppression of the amplification with the blockers.

Species Relative amount of amplicon*1 Relative amount of amplicon*2
No blocker 65°C No blocker 60°C BlockFish_long6 65°C BlockFishPNA 60°C
Cyprinus carpio ++ +++ - -
Carassius auratus langsdorfii + +++ - -
Amblygobius phalaena +++ +++ + -
Chrysiptera cyanea +++ +++ ++ -
Pomacentrus coelestis +++ +++ + -
Rhabdoblennius nitidus ++ ++ + -
Petroscirtes variabilis +++ ++ + -
Ellochelon vaigiensis  +++ +++ + -
Calotomus spinidens +++ +++ ++ -
Calotomus japonicus ++ +++ ++ -
Cetoscarus ocellatus +++ +++ + -
Scarus psittacus ++ +++ + -
Scarus ovifrons ++ +++ + -
Scarus ghobban +++ +++ + -
Chlorurus bleekeri + +++ - -
Naso vlamingii  - + ND -
Prionurus scalprum +++ +++ + -
Zebrasoma scopas +++ +++ + -
Acanthurus nigrofuscus +++ +++ + -
Acanthurus dussumieri  +++ +++ ++ -
Ctenochaetus striatus +++ +++ + -
Siganus argenteus +++ +++ + -
Girella punctata +++ +++ + -
Girella leonina +++ ++ + -

*1: Relative amount of amplicon when the amount of 500 bp band of the 100 bp ladder marker was regarded as 100%.

*2: Relative amount of amplicon when the amount of amplicon of control without blocker was regarded as 100%. -: amplicon was not observed. +: 0%< relative amount <50%,++: 50%≦ relative amount <100%, +++: 100%≦ relative amount. ND: no data.

Mock community analysis

To evaluate the applicability of the blockers to metabarcoding analysis, the 18S rDNA V8–V9 region was amplified via PCR with blockers using the mock community samples (Table 3) as templates. The results showed that the proportions of fish reads of samples 1, 2, and 3 without blockers at an annealing temperature of 65°C were, 18.4%, 74.2%, and 97.0%, respectively (Fig 4). The proportions of fish reads in samples 4, 5, and 6 at an annealing temperature of 65°C with BlockFish_long6 were 12.3%, 64.1%, and 93.8%, respectively (Fig 4). Compared with each control (PCR amplified without blocker), the suppression efficiencies of fish reads by BlockFish_long6 in the samples were 32.9%, 13.6%, and 3.3%, respectively.

Fig 4. Proportion of read numbers of the organisms contained in the mock community samples obtained by metabarcoding analysis.

Fig 4

*1: Samples shown in Table 3. *2: Proportion of fish reads to all reads obtained for each sample.

Thus, it was deduced that a higher amount of fish DNA in the mock community was corelated with less effective suppression of fish DNA with BlockFish_long6 (Fig 4). The proportions of fish reads in samples 7, 8, and 9 without blockers at an annealing temperature of 60°C were 19.3%, 77.5%, and 97.3%, respectively. In contrast, the proportions of fish reads in samples 10, 11, and 12 at an annealing temperature of 60°C with BlockFishPNA were 0.00%, 0.2%, and 0.7%, respectively (Fig 4).

Compared with each control (PCR amplified without blocker), the suppression efficiencies of fish reads by BlockFishPNA in the samples were 99.9%, 99.7%, and 99.3%, respectively. These results showed that the suppression efficacy of fish DNA amplification with BlockFishPNA did not decrease, even when the concentration of fish DNA added as a template was increased, whereas that with BlockFish_long6 decreased when the concentration of fish DNA increased.

Discussion

Design of blockers suitable for suppressing fish DNA amplification

Both BlockFish5 and BlockFish10, which have 5 bp- and 10 bp-overlap regions in the blocking primers with the reverse universal primer, respectively, hardly suppressed fish DNA amplification at annealing temperatures of 60°C and 65°C, and the relative amounts of amplicons with BlockFish5 and BlockFish10 were not significantly different at any of the annealing temperatures tested. The results indicated that the extension of the overlap regions in the blockers from 5 bp to 10 bp with the universal primer did not enhance the suppression of fish DNA amplification. In contrast, BlockFish_long6 suppressed fish DNA amplification at higher efficiencies than those of BlockFish5 and BlockFish10. The reason the relative amount of amplicons with the former blocker was smaller than those with the latter was reasoned to be due to the more efficient annealing of the former than the latter to the target fish DNA as a result of the high Tm of the former (67.4°C) compared with that of the latter (54.2°C and 60.4°C). These results suggest that the length of the overlap region in a blocking primer with the PCR primer may not be important, and a high Tm of a blocking primer may be a key factor in suppressing DNA amplification.

Annealing temperature suitable for suppressing fish DNA amplification

Suppression of fish DNA amplification increased as the annealing temperature of the blocking primer increased. In particular, BlockFish_long6 suppressed DNA amplification more efficiently at 65°C and 66°C compared with other blocking primers, whereas the relative amount of the products amplified with only the universal primers decreased at higher annealing temperatures, especially at 66°C. Thus, 65°C, at which DNA amplification was highly suppressed with the blocker and a relatively high amount of amplicons was obtained without the blocker, was selected as the optimal annealing temperature for the blocking primer as well as for the universal primers used. The results suggest that it is necessary to clarify the annealing temperatures that are critical to maintaining a certain level of DNA amplification efficiency so that target DNA amplification is efficiently suppressed.

Because BlockFishPNA completely suppressed fish DNA amplification at all of the annealing temperatures tested (60°C, 65°C, and 66°C), 60°C was selected as the annealing temperature for BlockFishPNA, at which the highest amount of amplicon was obtained without a blocker. Suppression of DNA amplification at all temperatures was considered to have occurred due to the Tm (77.5°C) of BlockFishPNA being >15°C higher than those of the universal primers (58.8°C and 58.6°C –61.5°C). Chow et al. [49] reported that a PNA clamp with 73.7°C Tm targeting the Japanese spiny lobster (Panulirus japonicus) suppressed DNA amplification at all of the tested annealing/extension temperatures (53°C, 55°C, 58°C, and 60°C), which were >13°C lower than the Tm of the PNA clamp. These results suggest that the PNA clamp has a high efficiency for suppression of DNA amplification, even under low annealing temperatures. Consequently, PNA clamps might be more applicable than blocking primers for suppressing target DNA amplification.

Concentration of blockers suitable for suppressing fish DNA amplification

In this study, the higher the concentration of the blocking primers, the more efficient the suppression of the target DNA amplification. Su et al. [30] investigated the effect of various concentrations of blocking primers on the suppression of fish DNA (Acanthopagrus latus, Pampus argenteus, and Scomberomorus commerson) amplification. They added the blocking primer at increasing concentrations of 1-, 3-, 5-, and 10-fold that of the universal primers and found that the blocker efficiency in suppressing DNA amplification of these fish correspondingly increased [30]. Other studies have demonstrated that the higher the concentration of the blocking primer, the more efficient the suppression of the target DNA amplification [24, 50, 51]. These results suggest that the optimal concentration of a blocking primer is 10-fold that of the universal primers.

In terms of the concentration of the PNA clamp, Chow et al. [49] added PNA at approximately 5- and 10-fold higher concentrations that that of the universal primers and found that both concentrations were highly effective in suppressing DNA amplification. In the present study, DNA amplification was completely suppressed, even if the PNA clamp was added at the same concentration as that of the universal primers. These results suggest that the PNA clamp may be used at the same concentration as that of the PCR primers. Considering that a PNA clamp is expensive, we recommend clarifying the minimum concentration required of each PNA clamp to stably suppress DNA amplification.

Applicability of the blockers to various herbivorous fish

When BlockFishPNA was used to suppress the amplification of DNA of various herbivorous fish, the relative amount of amplicon was 0% for all fish species tested, i.e., 100% suppression efficiency of PCR amplification. In contrast, the relative amount of amplicons with BlockFish_long6 differed depending on the genomic DNA used as templates, even if all the fish genomic DNA had no mismatch with the BlockFish_long6 sequence, which indicated that the difference in the relative amount of amplicons with BlockFish_long6 was not caused by the presence of mismatches. The reason why the amount of amplicons of the samples used differed may be because the balance between DNA amplification and suppression by the blocker might be altered by differences in DNA amplification efficiencies due to the extent of ‘contaminants’ in the template genomic DNA. This hypothesis suggests that purifying the template DNA thoroughly is a beneficial step when a blocking primer is used.

Effect of the blockers on suppressing fish DNA amplification in the metabarcoding of mock communities

In the results of metabarcoding of the mock community samples, the suppression efficiency of BlockFish_long6 was low (3.3%–32.9%, Fig 4), whereas the suppression efficiency of BlockFish_long6 was high (92.18%) when PCR was performed using only fish genomic DNA as a template under the same conditions (Fig 2B). In relation to these results, Takahashi et al. [31] designed a blocking primer targeting carnivorous fish (Lutjanidae) and investigated how efficient it was in suppressing the amplification of target DNA. They reported that the efficiency of suppressing DNA amplification was high when only Lutjanidae (target) DNA was used as a template, whereas the efficiency was low when a mock sample containing not only the target DNA but other DNA were used as templates. The reason for the difference in the results was not described in their report. Considering their results as well as our results, suppression efficiencies of the blocking primer differed with the results of the PCR test using only the target DNA as the template and the mock test containing other DNA as well as target DNA may be because ‘contaminants’ in some DNA added to the mock samples might affect DNA amplification efficiencies and alter the balance between DNA amplification and suppression. This hypothesis suggests that purifying the template DNA used to prepare mock samples is beneficial.

On the other hand, the suppression efficiency of BlockFishPNA was high when metabarcoding of mock community samples and PCR were performed using only the fish genomic DNA as a template. The reason why the PNA clamp was more efficient than the blocking primer was considered to be due to the Tm of BlockFishPNA being higher than that of BlockFish_long6. The results suggest that a PNA clamp is more effective than a blocking primer to consistently suppress the amplification of the target DNA when metabarcoding is conducted using a blocker.

The relative proportion of reads of non-fish organisms in the mock samples with and without BlockFish_long6 was almost the same, which indicated that the BlockFish_long6 developed in this study did not bind to the DNA of non-fish organisms. The fact that there were ≥5 bp mismatches between the sequences of the organisms other than fish (Scarus ovifrons) in the mock community, and the sequence of BlockFish_long6 suggests that the blocking primers do not generally bind to sequences of organisms with ≥5 bp mismatches (S3 Table). On the other hand, Piñol et al. [51] developed a blocking primer targeting Orius majusculus (Insecta) and investigated the usefulness of the blocking primer when using mock community samples for metabarcoding. They reported that the blocking primer suppressed DNA amplification, even when the DNA had 5 bp mismatches with the sequence of the blocking primer was used as a template in the mock community sample. These results suggest that investigating the ‘blocking characteristic’ of each blocking primer is desirable.

The effect of a PNA clamp on suppressing the amplification of target and non-target DNA in mock community samples has not been investigated. As far as we know, this study is the first to report the usefulness of a PNA clamp when performing metabarcoding of a mock community. In this study, the relative proportion of reads of non-fish organisms in the mock samples with and without BlockFishPNA was almost the same, which indicated that the BlockFishPNA designed in this study did not suppress the DNA amplification of sequences of organisms having at least 5 bp mismatches with the sequence of the PNA clamp and did not affect the proportion of reads of non-target organisms. Moreover, Terahara et al. [37] developed a PNA clamp targeting Anguilla japonica (Teleostei) and reported that the PNA clamp did not suppress DNA amplification when the template DNA had 2 or 3 bp mismatches with the sequence of the PNA clamp. These results indicate that the PNA clamp did not suppress DNA amplification of the sequences of organisms having at least 5 bp or potentially 2 bp mismatches with the sequence of the PNA clamp, and the PNA clamp did not affect the proportion of reads of non-target organisms.

Conclusion

In this study, we designed several DNA blockers to suppress fish DNA amplification during metabarcoding of the gut contents of herbivorous fish and investigated the suppression efficiency of these blockers. Among them, BlockFish_long6, a blocking primer designed in this study, showed high suppression efficiency of fish DNA amplification when only fish DNA was used as a template. However, when BlockFish_long6 was used for metabarcoding the mock community, the suppression efficiency of fish DNA amplification was low. On the other hand, BlockFishPNA, the PNA clamp designed in this study, showed a high suppression efficiency of fish DNA amplification, even when the mock samples were used as a template for metabarcoding. Therefore, BlockFishPNA is considered to be optimal for metabarcoding of prey organisms of herbivorous fish and is expected to be applied to detect and analyze the prey organisms of various herbivorous fish species.

Supporting information

S1 Fig. Effect of annealing temperature in the control (18S rDNA amplification without the blocking primer or the PNA clamp) on fish 18S rDNA amplification.

a: Tukey-Kramer test: p<0.01. *: Relative amount of amplicon when the amount of amplicon at 60°C was regarded as 100%.

(TIF)

S2 Fig. Multiple alignment prepared for designing the universal primer and the blockers.

(TIF)

S1 Table. List of herbivorous fish used in this study.

(DOCX)

S2 Table. Number of 18S rDNA sequences of each taxon taken from NCBI for designing the universal reverse primer and fish (Teleostei) blockers.

(DOCX)

S3 Table. Number of mismatches between the sequence of each blocker and the 18S rDNA sequence of each taxon in the region of the blocker.

(DOCX)

Acknowledgments

We thank Shingo Seki (Kochi University), Anabelle Dece A. Espadero (Kochi University), Zenzo Imoto (Kochi University), and Kenzo Yamagata, for collecting fish samples. We also thank Chetan Chandrakant Gaonkar (Kochi University) and Hiroshi Funaki (Ehime University) for their support with the data analysis of the sequence. We also thank Dennis Murphy (Ehime University) for the revising this manuscript linguistically.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Clements KD, Raubenheimer D, Choat JH. Nutritional ecology of marine herbivorous fishes: ten years on. Funct Ecol. 2009; 23:79–92. doi: 10.1111/j.1365-2435.2008.01524.x [DOI] [Google Scholar]
  • 2.Bakker ES, Wood KA, Pagès JF, Veen GF, Christianen MJA, Santamaría L, et al. Herbivory on freshwater and marine macrophytes: A review and perspective. Aquat Bot. 2016; 135:18–36. doi: 10.1016/j.aquabot.2016.04.008 [DOI] [Google Scholar]
  • 3.Hughes TP, Rodrigues MJ, Bellwood DR, Ceccarelli D, Hoegh-Guldberg O, McCook L, et al. Phase shifts, herbivory, and the resilience of coral reefs to climate change. Curr Biol. 2007; 17:360–365. doi: 10.1016/j.cub.2006.12.049 [DOI] [PubMed] [Google Scholar]
  • 4.Hughes TP, Graham NAJ, Jackson JBC, Mumby PJ, Steneck RS. Rising to the challenge of sustaining coral reef resilience. Trends Ecol Evol. 2010; 25:633–642. doi: 10.1016/j.tree.2010.07.011 [DOI] [PubMed] [Google Scholar]
  • 5.Vergés A, Steinberg PD, Hay ME, Poore AGB, Campbell AH, Ballesteros E, et al. The tropicalization of temperate marine ecosystems: climate-mediated changes in herbivory and community phase shifts. Proc Royal Soc B. 2014; 281; doi: 10.1098/rspb.2014.0846 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bennett S, Wernberg T, Harvey ES, Santana-Garcon J, Saunders BJ. Tropical herbivores provide resilience to a climate-mediated phase shift on temperate reefs. Ecol Lett. 2015; 18:714–723. doi: 10.1111/ele.12450 [DOI] [PubMed] [Google Scholar]
  • 7.Lewis SM. The role of herbivorous fishes in the organization of a Caribbean reef community. Ecol Monograph. 1986; 56:183–200. doi: 10.2307/2937073 [DOI] [Google Scholar]
  • 8.Hata H, Ceccarelli D. Farming behaviour of territorial damselfishes. In Frédérich B, Parmentier E (eds) Biology of Damselfishes. New York: CRC Press; 2016 [Google Scholar]
  • 9.Duarte CM, Cebrián J. The fate of marine autotrophic production. Limnol Oceanogr. 1996; 41:1758–1766. doi: 10.4319/lo.1996.41.8.1758 [DOI] [Google Scholar]
  • 10.Mantyka CS, Bellwood DR. Direct evaluation of macroalgal removal by herbivorous coral reef fishes. Coral Reefs. 2007; 26:435–442. doi: 10.1007/s00338-007-0214-1 [DOI] [Google Scholar]
  • 11.Dorenbosch M, Bakker ES. Herbivory in omnivorous fishes: effect of plant secondary metabolites and prey stoichiometry. Freshw Biol. 2011; 56:1783–1797. doi: 10.1111/j.1365-2427.2011.02618.x [DOI] [Google Scholar]
  • 12.Hanmer J, White JW, Pawlik JR. Application of diet theory reveals context-dependent foraging preferences in an herbivorous coral reef fish. Oecologia. 2017; 184:127–137. doi: 10.1007/s00442-017-3855-y [DOI] [PubMed] [Google Scholar]
  • 13.Plass-Johnson JG, McQuaid CD, Hill JM. Stable isotope analysis indicates a lack of inter- and intra-specific dietary redundancy among ecologically important coral reef fishes. Coral Reefs. 2013; 32:429–440. doi: 10.1007/s00338-012-0988-7 [DOI] [Google Scholar]
  • 14.Prejs A. Herbivory by temperate freshwater fishes and its consequences. Environ Biol Fish. 1984; 10:281–296. doi: 10.1007/BF00001481 [DOI] [Google Scholar]
  • 15.Choat JH, Clements KD, Robbins WD. The trophic status of herbivorous fishes on coral reefs 1: Dietary analyses. Mar Biol. 2002; 140:613–623. doi: 10.1007/s00227-001-0715-3 [DOI] [Google Scholar]
  • 16.Mendes TC, Ferreira CEL, Clements KD. Discordance between diet analysis and dietary macronutrient content in four nominally herbivorous fishes from the Southwestern Atlantic. Mar Biol. 2018; 165:1–12. doi: 10.1007/s00227-018-3438-4 [DOI] [Google Scholar]
  • 17.Amundsen PA, Sánchez-Hernández J. Feeding studies take guts—critical review and recommendations of methods for stomach contents analysis in fish. J Fish Biol. 2019; 95:1364–1373. doi: 10.1111/jfb.14151 [DOI] [PubMed] [Google Scholar]
  • 18.Chelsky Budarf A, Burfeind DD, Loh WKW, Tibbetts IR. Identification of seagrasses in the gut of a marine herbivorous fish using DNA barcoding and visual inspection techniques. J Fish Biol. 2011; 79:112–121. doi: 10.1111/j.1095-8649.2011.02999.x [DOI] [PubMed] [Google Scholar]
  • 19.Gomi K, Nakamura Y, Kanda M, Honda K, Nakaoka M, Honma C, et al. Diel vertical movements and feeding behaviour of blue humphead parrotfish Scarus ovifrons in a temperate reef of Japan. J Fish Biol. 2021; 99:131–142. doi: 10.1111/jfb.14704 [DOI] [PubMed] [Google Scholar]
  • 20.Harms-Tuohy CA, Schizas N v., Appeldoorn RS. Use of DNA metabarcoding for stomach content analysis in the invasive lionfish Pterois volitans in Puerto Rico. Mar Ecol Prog Ser. 2016; 558:181–191. doi: 10.3354/meps11738 [DOI] [Google Scholar]
  • 21.Sousa LL, Silva SM, Xavier R. DNA metabarcoding in diet studies: Unveiling ecological aspects in aquatic and terrestrial ecosystems. Environmental DNA. 2019; 1:199–214. doi: 10.1002/edn3.27 [DOI] [Google Scholar]
  • 22.Shehzad W, Riaz T, Nawaz MA, Miquel C, Poillot C, Shah SA, et al. Carnivore diet analysis based on next-generation sequencing: Application to the leopard cat (Prionailurus bengalensis) in Pakistan. Mol Ecol. 2012; 21:1951–1965. doi: 10.1111/j.1365-294X.2011.05424.x [DOI] [PubMed] [Google Scholar]
  • 23.Pompanon F, Deagle BE, Symondson WOC, Brown DS, Jarman SN, Taberlet P. Who is eating what: diet assessment using next generation sequencing. Mol Ecol. 2012; 21:1931–1950. doi: 10.1111/j.1365-294X.2011.05403.x [DOI] [PubMed] [Google Scholar]
  • 24.Vestheim H, Jarman SN. Blocking primers to enhance PCR amplification of rare sequences in mixed samples—a case study on prey DNA in Antarctic krill stomachs. Front Zool. 2008; 5:283–284. doi: 10.1186/1742-9994-5-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Albaina A, Aguirre M, Abad D, Santos M, Estonba A. 18S rRNA V9 metabarcoding for diet characterization: a critical evaluation with two sympatric zooplanktivorous fish species. Ecol Evol. 2016; 6:1809–1824. doi: 10.1002/ece3.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Leray M, Agudelo N, Mills SC, Meyer CP. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: Unexpected prey revealed in the gut contents of two coral reef fish species. PLoS ONE. 2013; 8:e58076. doi: 10.1371/journal.pone.0058076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sousa LL, Xavier R, Costa V, Humphries NE, Trueman C, Rosa R, et al. DNA barcoding identifies a cosmopolitan diet in the ocean sunfish. Sci Rep. 2016; 6:28762. doi: 10.1038/srep28762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Corse E, Meglécz E, Archambaud G, Ardisson M, Martin JF, Tougard C, et al. A from-benchtop-to-desktop workflow for validating HTS data and for taxonomic identification in diet metabarcoding studies. Mol Ecol Resour. 2017; 17:146–159. doi: 10.1111/1755-0998.12703 [DOI] [PubMed] [Google Scholar]
  • 29.Jakubavičiute E, Bergström U, Eklöf JS, Haenel Q, Bourlat SJ. DNA metabarcoding reveals diverse diet of the three-spined stickleback in a coastal ecosystem. PLoS ONE. 2017; 12:e0186929. doi: 10.1371/journal.pone.0186929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Su M, Liu H, Liang X, Gui L, Zhang J. Dietary analysis of marine fish species: Enhancing the detection of prey-specific DNA sequences via high-throughput sequencing using blocking primers. Estuaries Coast. 2018; 41:560–571. doi: 10.1007/s12237-017-0279-1 [DOI] [Google Scholar]
  • 31.Takahashi M, DiBattista JD, Jarman S, Newman SJ, Wakefield CB, Harvey ES, et al. Partitioning of diet between species and life history stages of sympatric and cryptic snappers (Lutjanidae) based on DNA metabarcoding. Sci Rep. 2020; 10:4319. doi: 10.1038/s41598-020-60779-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Leray M, Meyer CP, Mills SC. Metabarcoding dietary analysis of coral dwelling predatory fish demonstrates the minor contribution of coral mutualists to their highly partitioned, generalist diet. PeerJ. 2015; 3:e1047. doi: 10.7717/peerj.1047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Igloi GL. Variability in the stability of DNA-peptide nucleic acid (PNA) single-base mismatched duplexes: Real-time hybridization during affinity electrophoresis in PNA-containing gels. Proc Natl Acad Sci USA. 1998; 95:8562–8567. doi: 10.1073/pnas.95.15.8562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ørum H. PCR clamping. Curr Issues Mol Biol. 2000; 2:27–30. doi: 10.1002/9783527678679.dg09253 [DOI] [PubMed] [Google Scholar]
  • 35.Sakaguchi SO, Shimamura S, Shimizu Y, Ogawa G, Yamada Y, Shimizu K, et al. Comparison of morphological and DNA-based techniques for stomach content analyses in juvenile chum salmon Oncorhynchus keta: a case study on diet richness of juvenile fishes. Fish Sci. 2017; 83:47–56. doi: 10.1007/s12562-016-1040-6 [DOI] [Google Scholar]
  • 36.Chow S, Inaba N, Nagai S, Kurogi H, Nakamura Y, Yanagimoto T, et al. Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific. PLoS ONE. 2019; 14:e0225610. doi: 10.1371/journal.pone.0225610 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Terahara T, Chow S, Kurogi H, Lee SH, Tsukamoto K, Mochioka N, et al. Efficiency of peptide nucleic acid-directed PCR clamping and its application in the investigation of natural diets of the Japanese eel leptocephali. PLoS ONE. 2011; 6:e25715. doi: 10.1371/journal.pone.0025715 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Nakabo T. Fishes of Japan with pictorial keys to the species. third ed. Tokyo: Tokai University Press; 2013. [Google Scholar]
  • 39.Helfman GS, Collette BB, Facey DE BB. The diversity of fishes. 2nd ed. London: Wiley-Blackwell; 2009. [Google Scholar]
  • 40.Clements KD, German DP, Piché J, Tribollet A, Choat JH. Integrating ecological roles and trophic diversification on coral reefs: multiple lines of evidence identify parrotfishes as microphages. Biol J Linn Soc. 2017; 120:729–751. doi: 10.1111/bij.12914 [DOI] [Google Scholar]
  • 41.Froese R PD. FishBase. World Wide Web electronic publication. 2018. Available: http://www.fishbase.org [Google Scholar]
  • 42.Sano M, Shimizu M NY. Food habits of teleostean reef fishes in Okinawa Island, southern Japan. Univ Mus Univ Tokyo Bull. 1984; 25:1–128. [Google Scholar]
  • 43.Nakamura Y, Horinouchi M, Nakai T, Sano M. Food habits of fishes in a seagrass bed on a fringing coral reef at Iriomote Island, southern Japan. Ichthyol Res 2003; 50:15–22. doi: 10.1007/s102280300002 [DOI] [Google Scholar]
  • 44.Bradley IM, Pinto AJ, Guest JS. Design and evaluation of Illumina MiSeq-compatible, 18S rRNA gene-specific primers for improved characterization of mixed phototrophic communities. Appl Environ Microbiol. 2016; 82:5878–5891. doi: 10.1128/AEM.01630-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Green MR SJ. Molecular cloning: a laboratory manual. 4th ed. New York: Cold Spring Harbor; 2012. [Google Scholar]
  • 46.Hartley JL BH. PEG precipitation for selective removal of small DNA fragments. Focus. 1996; 18:27. [Google Scholar]
  • 47.Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol. 2009; 75:7537–7541. doi: 10.1128/AEM.01541-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011; 27:2194–2200. doi: 10.1093/bioinformatics/btr381 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Chow S, Suzuki S, Matsunaga T, Lavery S, Jeffs A, Takeyama H. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping. Mar Biotechnol. 2011; 13:305–313. doi: 10.1007/s10126-010-9301-3 [DOI] [PubMed] [Google Scholar]
  • 50.Nishitani G, Shiromoto M, Sato-Okoshi W, Ishikawa A. Molecular approach for analysis of in situ feeding by the dinoflagellate Noctiluca scintillans. Harmful Algae. 2020; 99:101928. doi: 10.1016/j.hal.2020.101928 [DOI] [PubMed] [Google Scholar]
  • 51.Piñol J, Mir G, Gomez-Polo P, Agustí N. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods. Mol Ecol Resour. 2015; 15:819–830. doi: 10.1111/1755-0998.12355 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Ram Kumar

17 Feb 2022

PONE-D-21-29551Effectiveness of blocking primers and a peptide nucleic acid (PNA) clamp for 18S metabarcoding dietary analysis of herbivorous fishPLOS ONE

Dear Dr. Masao Adachi, 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by March 21, 2022. f you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ram Kumar, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

" ext-link-type="uri" xlink:type="simple">https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf"

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Thank you for stating the following financial disclosure:

 “CH No. 4350 The Japan Science Society https://www.jss.or.jp/en/

NO”

Please state what role the funders took in the study.  If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.""

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The manuscript have been reviewed by the three independent reviewers.

I thank you for considering the Plos One as potential vehicle of your research outcomes.

I am pleased to inform that all the three reviewers have recommended publication of the manuscript after minor revision. The comments and suggestions given by all the three reviewers are very pertinent . I would request you to revise the manuscript accordingly and resubmit for final decision. In addition to comments by three reviewers I think that the details of designing and selecting the primers are ambiguous , reviewers have also commented on this issue.

The manuscript is acceptable after incorporating all amendments suggested by the reviewers.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The study aims to assess the efficiency of PNA clamp to suppress the amplification of fish DNA and compare it with the efficiency of blocking primers. 24 species of herbivorous fish are tested in the study. The authors design three blocking primers and one PNA clamp to determine the organisms that are a part of the diet of herbivorous fish. The results clearly indicate the dominance of PNA clamp over blocking primers in suppressing the fish DNA amplification by a huge margin.

The results from this study could be of a good application in studying aquatic food web and nutrient cycle while being species specific. The manuscript is well written and comprehensible. All my comments and questions are stated herewith.

The authors have stated the limitations of previously used methods, but the limitations of DNA barcoding accompanied with molecular cloning as a method could be elaborated a little more to consolidate their point of the need for a new method (inclusion of PNA clamp in this case during amplification) because the point that it is laborious and time consuming (line 44-47) could be applicable to most of the processes described and is general in my opinion. As DNA barcoding has been previously used for determining the prey organism of Siganus fuscescens and Scarus ovifrons, I think it would be better to specify the limitations from that experiment as well to strengthen the claims made by the author.

Regarding the table no. 4. For langsdorfii, no observations are included in the table and the genus name has not been provided, please address to that as it has been mentioned in line no. 325-327 of the manuscript in relation to a 100% suppression by BlockFish_long7

Also, Since Naso vlamingii does not seem to produce amplicons without blockers at 65 and at 60 degrees Celsius, and produces only 0-50% of relative amount of amplicons, was it tested at lower annealing temperatures than 60 degrees to see if more amplicons are being produced for Naso vlamingii without the blocker. Was there any limitation that did not allow more observations for the said species such as the sample size or availability.

Please include the page numbers and make sure to review the submission guidelines for the journal to check the formatting of the manuscript.

A general question for someone not a specialist in this field, This is more of a personal curiosity regarding the use of V9 and V8f region, Is there a possibility to use any more regions on 18S rDNA or an inclusion of more regions of 18S rDNA as biomarker, if yes would that be beneficial or the results would be similar in preparing the blockers and PNA clamp?

Reviewer #2: The manuscript shows how efficiently the gut microbiology of herbivorous fish can be investigated by focusing on 18S rDNA of only prey organisms and blocking the DNA content of fish. The study was novel as the prey content has not been identified in herbivorous fish. The manuscript is well written. Would suggest minor revision. The changes required are:

1. The details of designing and selecting the primers were not clear in the manuscript. If added in supplementary, I would suggest to add that in the materials and methods section where the primer designing has been mentioned. Also mention from which organism/s each primers has been designed.

2. I feel metabarcoding results should also be properly mentioned. The prey organisms mentioned in Table 2 were only used for conducting mock tests? Incorporate the metabarcode analysis of prey organisms (the list of organisms or classes of organisms that are observed in fish by PCR blocking technique).

The manuscript can be accepted after incorporating these minor corrections.

Reviewer #3: Few corrections:

1. BlockFish_long7 has only 6 nucleotide overlap with the 18SV9R which does match with the text in line 119.

2. In the Table 2 labels of columns Mock 1, Mock 2 and Mock 3 does not give the idea about what the numbers given in the columns represent (in line 236 mentioned but it should be clearly labeled in table also)

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Malayaj Rai

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Apr 20;17(4):e0266268. doi: 10.1371/journal.pone.0266268.r002

Author response to Decision Letter 0


23 Feb 2022

Dear Reviewers,

We are grateful for your valuable comments and suggestions that have helped to improve our manuscript (MS), entitled "Effectiveness of the blocking primer and PNA clamp against for 18S metabarcoding dietary analysis of herbivorous fishes" by Chiho Homma, Daiki Inokuchi, Yohei Nakamura, Wilfredo H. Uy, Kouhei Ohnishi, Haruo Yamaguchi, Masao Adachi as an Original Research Article for publication in PLoS One. We have considered the comments and suggestions in the revised version of our MS. Responses to your comments are presented below.

Responses to Reviewer #1’s Comments:

Comment 1: The authors have stated the limitations of previously used methods, but the limitations of DNA barcoding accompanied with molecular cloning as a method could be elaborated a little more to consolidate their point of the need for a new method (inclusion of PNA clamp in this case during amplification) because the point that it is laborious and time consuming (line 44-47) could be applicable to most of the processes described and is general in my opinion. As DNA barcoding has been previously used for determining the prey organism of Siganus fuscescens and Scarus ovifrons, I think it would be better to specify the limitations from that experiment as well to strengthen the claims made by the author.

Response 1: Thank you for your suggestion. Considering your suggestion, we described the limitations from the DNA barcoding in the revised Introduction of our manuscript (revised MS Page 3, Lines 45 – 49) as described below:

‘The DNA barcoding [18,19] accompanied by single-stranded conformational polymorphism (SSCP) analysis or molecular cloning of PCR products circumvents the problem described above, but these approaches need DNA sequencing of many PCR products from the SSCP analysis or DNA sequencing of many clones derived from the PCR products, which are laborious and time-consuming [20].’

Comment 2: Regarding the table no. 4. For langsdorfii, no observations are included in the table and the genus name has not been provided, please address to that as it has been mentioned in line no. 325-327 of the manuscript in relation to a 100% suppression by BlockFish_long7

Response 2: Carassius auratus langsdorfi is one species name. In the original manuscript, there were separated into two lines, which made it difficult to understand. Therefore, the species name was shown in a single line in Table 4 in the revised MS.

Comment 3: Also, Since Naso vlamingii does not seem to produce amplicons without blockers at 65 and at 60 degrees Celsius, and produces only 0-50% of relative amount of amplicons, was it tested at lower annealing temperatures than 60 degrees to see if more amplicons are being produced for Naso vlamingii without the blocker. Was there any limitation that did not allow more observations for the said species such as the sample size or availability.

Response 3: In Table 4, we showed effectiveness of BlockFish_long6 and BlockFishPNA to various fishes. No amplicon of Naso vlamingii was obtained at 65℃, but an amplicon of it was obtained at 60°C, although the amount of the amplicon was small (0-50%). We think that it is not necessary to test the effectiveness of blockers at lower annealing temperatures than 60 degrees, because non-specific amplification may occur if the annealing temperature is lowered below this temperature (60 degrees) which is about Tm of the universal primer. So we did not test temperatures less than 60℃.

Comment 4: Please include the page numbers and make sure to review the submission guidelines for the journal to check the formatting of the manuscript.

Response 4: Following your suggestion, we have added the page numbers in the revised MS. Thank you.

Comment 5: A general question for someone not a specialist in this field, This is more of a personal curiosity regarding the use of V9 and V8f region, Is there a possibility to use any more regions on 18S rDNA or an inclusion of more regions of 18S rDNA as biomarker, if yes would that be beneficial or the results would be similar in preparing the blockers and PNA clamp?

Response 5: We think that it is possible to use regions other than 18S rDNA V8-V9 used in this study, such as mitochondrial CO1 as barcode regions. In the cases, it is important to consider a use of a PNA clamp or a use of a blocking primer having higher Tm than that of a universal PCR primer. In addition, it is desirable to optimize the concentration of the blocker and the annealing temperature as investigated in this study.

Responses to Reviewer #2’s Comments:

Reviewer #2: The manuscript shows how efficiently the gut microbiology of herbivorous fish can be investigated by focusing on 18S rDNA of only prey organisms and blocking the DNA content of fish. The study was novel as the prey content has not been identified in herbivorous fish. The manuscript is well written. Would suggest minor revision. The changes required are:

Comment 1: The details of designing and selecting the primers were not clear in the manuscript. If added in supplementary, I would suggest to add that in the materials and methods section where the primer designing has been mentioned. Also mention from which organism/s each primers has been designed.

Response 1: We created a multiple alignment using the 226 Teleostei sequences, 2,713 sequences of various eukaryotic organisms other than Telostei from NCBI (Table S2), and the 24 fish sequences determined in this study. In the revised manuscript, we showed the alignment in Fig. S2 (Please check the figure in an attached file as Response to reviewers) which shows the annealing sites of the newly designed universal reverse primer 18SV9R, the blocking primers and the PNA clamp used in this study.

Comment 2: I feel metabarcoding results should also be properly mentioned. The prey organisms mentioned in Table 2 were only used for conducting mock tests? Incorporate the metabarcode analysis of prey organisms (the list of organisms or classes of organisms that are observed in fish by PCR blocking technique).

Response 2: We are sorry that we have not yet applied the metabarcode analysis using the blockers to analysis of prey organisms of herbivorous fishes. In future, we would like to report prey organisms of various herbivorous fishes analyzed by a metabarcode analysis using the blockers reported in this study.

Responses to Reviewer #3’s Comments:

Comment 1: BlockFish_long7 has only 6 nucleotide overlap with the 18SV9R which does match with the text in line 119.

Response 1: Considering your comment, we have changed the name of the blocker from BlockFish_long7 to BlockFish_long6 in the text as well as all figures and tables. Thank you.

Comment 2: In the Table 2 labels of columns Mock 1, Mock 2 and Mock 3 does not give the idea about what the numbers given in the columns represent (in line 236 mentioned but it should be clearly labeled in table also)

Response 2: Considering your comment. we have explained the meaning of the number in the footnote of the table as shown below:

‘Number in column showed a ratio of each organism in the mock community samples.’

References

We have inserted spaces before volume numbers and deleted spaces before page numbers.

We have added information about article numbers or a volume number of some references (Ref.: 5, 19, 26, 27, 29, 31, 32, 36, 37).

We have changed the doi of Ref: 44.

Attachment

Submitted filename: Response to Reviewers combined 021922.docx

Decision Letter 1

Ram Kumar

18 Mar 2022

Effectiveness of blocking primers and a peptide nucleic acid (PNA) clamp for 18S metabarcoding dietary analysis of herbivorous fish

PONE-D-21-29551R1

Dear Dr. adachi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ram Kumar, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Dear Prof Masao Adachi

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Thank you ones again for considering the PLOSE ONE as potential vehicle of disseminating your research outcomes.

Prof. Ram Kumar

Handling Editor

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The study effectively shows the potential for use of blocking primer and 18S metabarcoding as a means of dietary analysis of herbivorous fish by blocking the expression of fish DNA during amplification. The study is novel and has potential for future works related to the accurate identification of prey using metabarcoding as well which would provide information that could be experimented in aquaculture industry. All my questions and suggestions have been addressed to.

Reviewer #2: All the questions have been addressed. In the acknowledgement section, pls remove 'the' mentioned in the line 502-503 (for "the" revising). Can be accepted.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Rai, Malayaj

Reviewer #2: No

Acceptance letter

Ram Kumar

8 Apr 2022

PONE-D-21-29551R1

Effectiveness of blocking primers and a peptide nucleic acid (PNA) clamp for 18S metabarcoding dietary analysis of herbivorous fish

Dear Dr. Adachi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Ram Kumar

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Effect of annealing temperature in the control (18S rDNA amplification without the blocking primer or the PNA clamp) on fish 18S rDNA amplification.

    a: Tukey-Kramer test: p<0.01. *: Relative amount of amplicon when the amount of amplicon at 60°C was regarded as 100%.

    (TIF)

    S2 Fig. Multiple alignment prepared for designing the universal primer and the blockers.

    (TIF)

    S1 Table. List of herbivorous fish used in this study.

    (DOCX)

    S2 Table. Number of 18S rDNA sequences of each taxon taken from NCBI for designing the universal reverse primer and fish (Teleostei) blockers.

    (DOCX)

    S3 Table. Number of mismatches between the sequence of each blocker and the 18S rDNA sequence of each taxon in the region of the blocker.

    (DOCX)

    Attachment

    Submitted filename: Response to Reviewers combined 021922.docx

    Data Availability Statement

    All relevant data are within the paper and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES