Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the genes used in real-time PCR analysis.
| Name | Symbol | Primer Sequence |
|---|---|---|
| Rattus norvegicus actin, beta (Actb) | β-actin | F: AGGGAAATCGTGCGTGACAT R: CCGATAGTGATGACCTGACC |
| Rattus norvegicus 5-hydroxytryptamine receptor 1A (Htr1a) | 5HT1 | F: GTCCACTTGTTGAGCACCTG R: ACGTGACCTTCAGCTACCAA |
| Rattus norvegicus 5-hydroxytryptamine receptor 2A (Htr2a) | 5HT2 | F: TAGTTTGGCTCGAGTGCTGA R: TCCATGCCAATCCCAGTCTT |
