TABLE 2.
Primers used in this study
| Primer | Sequence (5′ to 3′) | Location |
|---|---|---|
| 4a | CATTAAAATCCCGATAGC | +651 to +634 downstream of the pbpB start codon (strain Verdun) |
| 8a | GAGTCATCTTTCTCACGT | +88 to +105 downstream of the pbpB start codon (strain Verdun) |
| 11a | TAGTTTTGAGTAGTGATC | −76 to −59 upstream of the pbpB start codon (strain Verdun) |
| 36a | CGGTATTCTCGGGATTAT | −389 to −372 upstream of the pbpB start codon (strain Verdun) |
| 12a | CTCCCGCGACTTCTATGT | −727 to −710 upstream of the pbpB stop codon (strain Verdun) |
| 29a | CCGAAATCCCAAGAGGTC | −92 to −109 upstream of the pbpB stop codon (strain Verdun) |
| 38a | AGGCCGAACTCTGAGAAA | +198 to +181 downstream of the pbpB stop codon (strain Verdun) |
| 39a | TCTAAGTCTACCGGATTC | +520 to +503 downstream of the pbpB stop codon (strain Verdun) |
| 3b | AGCGGCTTCTTGTTTATC | +1091 to +1074 downstream of the ponA start codon (strain Verdun) |
| Z157b | GTCAGTCAAATTCGTCCA | +219 to +236 downstream of the ponA start codon (strain Verdun) |
| 15b | CTTATTCTACATACAAGG | −390 to −373 upstream of the ponA start codon (strain Verdun) |
| 7b | GCCTGTGCAGAAACGATC | −600 to −583 upstream of the ponA stop codon (strain Verdun) |
| Z195b | TCTCCATCTTCTGCTTGA | −53 to −70 upstream of the ponA stop codon (strain Verdun) |
| 12b | TGGCGGAAACAGGGCGCA | +193 to +176 downstream of the ponA stop codon (strain Verdun) |
| 17b | CAAAATCATTCTCATAAG | +498 to +481 downstream of the ponA stop codon (strain Verdun) |
| pbp1begc | GAGGCCGGCTCCAATGGATTTGAA | +38 to +15 downstream of the ponA start codon (strain Verdun) |
| pbp1endc | CCAGAAACTACAGATAATCCTCCA | −27 to −4 upstream of the ponA stop codon (strain Verdun) |
| pbp3begc | TCGTGAGTCTAGTTTTACGGGAAT | +27 to +43 downstream of the pbpB start codon (strain Verdun) |
| pbp3endc | AGCGGGTTTTGTTACGAGCAGGAA | −75 to −52 upstream of the pbpB stop codon (strain Verdun) |
| oligo5.4UPc | GAGTTCAATGGATTCAACACTTGT | Strain Verdun |
| oligo5.4RPc | GAGCGGTCATCTGTTTATGGTTGT | Strain Verdun |
| PBP3Ld | GGGGGGGGATCCGAATGAACGAGAAGTAGTTCTAAAAACTGG | +95 to +124 downstream of the pbpB start codon (BamHI) (strain Verdun) |
| PBP3Md | GGGGGGCTCGAGCTTAAAATATAAATTAAGTCTTCCGTTTTC | −30 to −1 upstream of the pbpB stop codon (XhoI) (strain Verdun) |
| 121b | AGTTCCATCGGAGACAATTC | +1661 to +1642 of ponA (strain RZ11) |
| 173b | GATCAACACAATCGCAGTCA | +1500 to +1519 of ponA for genome walking (strain RZ11) |
| 184c | CTTAAAGCCTGAGTCGTTTC | 84 bp downstream of ponA (strain RZ11) |
| 185c | GTCGTCATCCATTCCTGTAA | +467 to +448 of pbpB (strain RZ11) |
| 186c | GCAGTCAATTGGCTCCTTAT | +681 to +700 of pbpB (strain RZ11) |
| 921 | CCGATCTTGTAAGAAGAGAA | −19 to +1 of pbpB |
| 922 | CCGAACTCTGAGAAATAGAA | 173 bp downstream of the pbpB stop codon |
| 155 | GCGCTTTTGATCCGTTCC | Starts 232 bp upstream of ponA (strain RZ11) |
| 513 | TTAGAATGAGAGGAGACGAGGAGAATA | Starts 389 bp downstream of ponA (strain RZ11) |
a
Primers used for pbpB RT-PCR.
b
Primers used for ponA RT-PCR.
c
Primers used for the LD-PCR.
d
BamHI and XhoI sites are underlined.