| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| mouse monoclonal anti-Fasciclin 3 (7G10) (1:50) | Developmental studies hybridoma bank (DSHB) | RRID: AB_528238 |
| mouse monoclonal anti-Eyes absent (10H6) (1:10) | DSHB | RRID: AB_528232 |
| rat anti-shg/DE-Cadherin (DCAD2) (1:20) | DSHB | RRID: AB_528120 |
| mouse anti-Hts (1B1) (1:10) | DSHB | RRID: AB_528070 |
| mouse anti-Ptc (Apa 1.3) (1:500) | DSHB | RRID: AB_528441 |
| mouse anti-LamDm0 (ADL101) (1:50) | DSHB | RRID: AB_528332 |
| mouse anti-LamC (LC28.26) (1:50) | DSHB | RRID: AB_528339 |
| rabbit anti-Vasa (d260) (1:100) | Santa Cruz Biotechnology | Cat#sc-30210; RRID: AB_793874 |
| rabbit anti-pSmad1/5 (41D10) (1:100) | Cell Signaling Technology | Cat#9516T; RRID: AB_491015 |
| chicken anti-Green Fluorescent Protein (GFP-1020) (1:1000) | Aves Labs | Cat#GFP-1020; RRID: AB_10000240 |
| rabbit anti-P-4E-BP1 (Thr37/46 236B4, 2855S) (1:500) | Cell Signaling Technology | Cat#2855; RRID: AB_560835 |
| rabbit anti-Zfh1 (1:500) | Ruth Lehmann (New York University) | N/A |
| rabbit anti-Stat92E (1:800) | Denise Montell (UCSB) | N/A |
| guinea pig anti-Traffic Jam (1:100) | Dorothea Godt (U. Toronto, Canada) | RRID: AB_2568583 |
| Mouse monoclonal anti-phospho-Histone H3 (Ser10) (6G3) | Cell Signaling Technology | Cat#9706; RRID: 331748 |
| Chemicals, peptides, and recombinant proteins | ||
| Rapamycin | TSZCHEM | Cat#R1017; CAS#53123-88-9 |
| Trizol | Life Technologies | Cat#15596026 |
| Linear Poly-Acrylamide | Sigma | Cat#56575 |
| DNase Q1 | Promega | Cat# M610A |
| iScriptkit | Biorad | Cat#170-8841 |
| Sso Advanced SYBR Green | Biorad | Cat#1725-264 |
| Critical commercial assays | ||
| Click-iT™ Plus EdU Cell Proliferation Kit for Imaging, Alexa Fluor™ 555 dye | Invitrogen/ThermoFisher | Cat# C10638 |
| Deposited data | ||
| Dam:Esg raw array data | This paper | GEO: GSE157685 |
| Experimental models: Cell lines | ||
| D. melanogaster: Cell line S2: S2- NLAP | (Voog et al., 2014) | N/A |
| D. melanogaster: Cell line S2: S2- NLAP:Esg | (Voog et al., 2014) | N/A |
| D. melanogaster: Cell line S2: S2- NLAP:EsgG387E | (Voog et al., 2014) | N/A |
| Experimental models: Organisms/strains | ||
| D. melanogaster: tub-Gal80TS | Bloomington Drosophila Stock Center | BDSC:7108 |
| D. melanogaster: UAS-InRRNAi [JF01482] | Bloomington Drosophila Stock Center |
BDSC:31037 |
| UAS-esgRNAi[HMS02538] | Bloomington Drosophila Stock Center |
BDSC:42846 |
| D. melanogaster: D. melanogaster: UAS-InRA1325D (“InRCA”) | Bloomington Drosophila Stock Center |
BDSC:8440 |
| D. melanogaster: UAS-IVS-myr::TdTomato | Bloomington Drosophila Stock Center |
BDSC:32221 |
| D. melanogaster: UAS-ImpL2RNAi[GD6004] | Vienna Drosophila RNAi Center | v30930 |
| D. melanogaster: UAS-esgRNAi[GD1437] | Vienna Drosophila RNAi Center | v9793 |
| D. melanogaster: UAS-ImpL2, UAS-ImpL2 | Kyoto Stock Center | DGRC:117649 |
| D. melanogaster: ptc-GFP (enhancer trap) | Carnegie collection, through A. Spradling and M. Buszczak (Carnegie Institution of Washington) | CB02030 |
| D. melanogaster: UAS-esgNLAP | (Voog et al., 2014) | N/A |
| D. melanogaster: esg-GFP | Lynn Cooley, Yale | P01986 |
| D. melanogaster: esgEP2009 | Berkeley Drosophila Genome Project, ((Rørth et al., 1998); (Abdelilah-Seyfried et al., 2000)) | N/A |
| D. melanogaster: w1118 | D. Walker, UCLA | FBal0018186 |
| D. melanogaster: c587-Gal4 | T. Xie (Stowers Institute of Biomedical Research) | N/A |
| D. melanogaster: UAS-Dam-esg | (Loza-Coll et al., 2014) | N/A |
| D. melanogaster: UAS-Dam | (Loza-Coll et al., 2014) | N/A |
| Oligonucleotides | ||
| Primer Act5C For: TTGTCTGGGCAAGAGGATCAG | (Senos Demarco et al., 2020) | N/A |
| Primer Act5C Rev: ACCACTCGCACTTGCACTTTC | (Senos Demarco et al., 2020) | N/A |
| InR Fwd: GCACCATTATAACCGGAACC | This paper | N/A |
| InR Rev: TTAATTCATCCATGACGTGAGC | This paper | N/A |
| ImpL2 Fwd: GCCGATACCTTCGTGTATCC | This paper | N/A |
| ImpL2 Rev: TTTCCGTCGTCAATCCAATAG | This paper | N/A |
| Esg Fwd: CGCCAGACAATCAATCGTAAGC | (Loza-Coll et al., 2014) | N/A |
| Esg Rev: TGTGTACGCGAAAAAGTAGTGG | (Loza-Coll et al., 2014) | N/A |
| Software and algorithms | ||
| Prism v6.0 | Graphpad | N/A |
| Illustrator CC 2015 | Adobe | N/A |
| Photoshop CC 2015 | Adobe | N/A |
| Image J v2.0.0 | Wayne Rasband, NIH | http://imagej.nih.gov/ij |
| CFX ManagerTM | Biorad | N/A |