Table 2.
Primers used for gender genotyping PCR
| Primer | Sequence (5’-3’) | Expected size (bp) |
|---|---|---|
| Sex primer-F | CACCTTAAGAACAAGCCAATACA | X chromosome = 269bp |
| Sex primer-R | GGCTTGTCCTGAAAACATTTGG | Y chromosome = 353bp |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.