Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2022 Mar 9;10(2):e02355-21. doi: 10.1128/spectrum.02355-21

Synergistic Effects of Licorice Root and Walnut Leaf Extracts on Gastrointestinal Candidiasis, Inflammation and Gut Microbiota Composition in Mice

Hélène Authier a,, Valérie Bardot b, Lucile Berthomier b, Bénédicte Bertrand a, Claude Blondeau c, Sophie Holowacz c,, Agnès Coste a,
Editor: Renato Kovacsd
PMCID: PMC9045305  PMID: 35262409

ABSTRACT

Candida albicans is an opportunistic pathogen that causes gastrointestinal (GI) candidiasis closely associated with intestinal inflammation and dysbiosis. Drug resistance, side effects of available antifungal agents, and the high recurrence of candidiasis highlight the need for new treatments. We investigated the effects of hydroethanolic extracts of licorice root (LRE) and walnut leaf (WLE) on GI colonization by C. albicans, colon inflammation, and gut microbiota composition in C57BL/6 female mice. Oral administration of LRE and WLE alone or in combination once daily for 12 days before C. albicans infection and then for 5 days after infection significantly reduced the level of C. albicans in the feces of gastrointestinal infected mice as well as colonization of the GI tract, both extracts showing robust antifungal activity. Although total bacterial content was unaffected by the extracts (individually or combined), the abundance of protective bacteria, such as Bifidobacterium spp. and Faecalibacterium prausnitzii, increased with the combination, in contrast to that of certain pathobiont bacteria, which decreased. Interestingly, the combination induced a more robust decrease in the expression of proinflammatory genes than either extract alone. The anti-inflammatory activity of the combination was further supported by the reciprocal increase in the expression of anti-inflammatory cytokines and the significant decrease in enzymes involved in the synthesis of proinflammatory eicosanoids and oxidative stress. These findings suggest that LRE and WLE have synergistic effects and that the LRE/WLE combination could be a good candidate for limiting GI candidiasis and associated inflammation, likely by modulating the composition of the gut microbiota.

IMPORTANCE The adverse effects and emergence of resistance of currently available antifungals and the high recurrence of candidiasis prompt the need for alternative and complementary strategies. We demonstrated that oral administration of hydroethanolic extracts of licorice root (LRE) and walnut leaf (WLE) separately or in combination significantly reduced the colonization of the gastrointestinal (GI) tract by C. albicans, highlighting a robust antifungal activity of these plant extracts. Interestingly, our data indicate a correlation between LRE and WLE consumption, in particular the combination, and a shift within the gut microbiome toward a protective profile, a decrease in colonic inflammation and prooxidant enzymes, suggesting a synergistic effect. This study highlights the significant prebiotic potential of the LRE/WLE combination and suggests that the health benefits are due, at least in part, to their ability to modulate the gut microbiota, reduce inflammation and oxidative stress, and protect against opportunistic infection.

KEYWORDS: candidiasis, gut inflammation, licorice, plant extract, prebiotic, walnut, microbiota

INTRODUCTION

Candida albicans inhabit the gastrointestinal (GI) tract of most healthy individuals (1, 2). As a commensal member of the microbiota, the yeast is generally harmless, but it can become an opportunistic pathogen, particularly in individuals with impaired immunity (1). C. albicans is a major cause of infections worldwide; it commonly triggers superficial mucosal infections and may also, under favorable conditions, lead to potentially life-threatening deep tissue infections (1).

The GI tract is a key reservoir of C. albicans, and the fungus is well adapted to growth in the environment provided by the GI tract and to the changes that can take place within this, for example, following the use of antibiotics (2, 3). In addition, C. albicans has been associated with several GI diseases, such as celiac disease and inflammatory bowel diseases (37). C. albicans is thought to exacerbate inflammatory processes due to a sequence of mutually perpetuating events, including dysbiosis and low-grade inflammation in the gut that sustains the growth of the fungus while its excessive growth fosters further inflammation, increasing lesions and delaying healing (2, 3, 6). C. albicans is, therefore, considered to be involved in the pathogenesis of certain gastrointestinal diseases.

The emergence of drug resistance, the adverse effects of available antifungal agents, and the high recurrence rate of candidiasis have necessitated a search for new therapies. This has led to an increased interest in exploring the potential of plants for the treatment of fungal infections (8, 9).

The antifungal potential of licorice (Glycyrrhiza glabra L.) and walnut (Juglans regia L.) among other plants have been evaluated in several in vitro and in vivo studies. A propylene glycol extract of a dry powder of licorice roots inhibited the growth of C. albicans in vitro (10). Other studies investigated major phytochemical compounds extracted from licorice roots, such as the saponin glycyrrhizin, the aglycone of glycyrrhizin 18β-glycyrrhetinic acid, the chalcone licochalcone A, and the isoflavonoid glabridin (1117). All these studies have contributed to demonstrating the antifungal potential of these compounds and thus of licorice root against C. albicans infections. For example, in an in vivo study with glycyrrhizin, mice were inoculated with C. albicans at lethal doses with or without previous administration of glycyrrhizin at the dose of 0.5 mg/kg/day for 15 to 20 days. Prior administration of glycyrrhizin decreased the mortality rate from 100% to 65%. Mean survival time increased from 7 to 11 days and symptom severity decreased (11).

There are fewer studies on the antifungal effects of a walnut leaf. The antifungal activity of walnut has been reported in a few in vitro studies evaluating different types of extracts. A hydromethanolic extract of walnut leaf was found to be the most effective of the plant extracts tested in vitro against C. albicans and other Candida species (18), confirming previous observations in studies investigating methanol, ethyl acetate, diluted acetone (19), and hydroethanolic extracts (20). It should be noted that in a study assessing aqueous extracts of different walnut leaf cultivars, no effect was observed on the tested fungi (C. albicans and C. neoformans) and Gram-negative bacteria species (Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae). Only the growth of Gram-positive bacteria (Bacillus cereus, B. subtilis, and Staphylococcus aureus) was inhibited by these extracts (21).

In addition to their direct effects on C. albicans and their immunomodulatory properties, plants and their secondary metabolites have been shown to have prebiotic effects (2227). These could be of interest in the context of GI candidiasis and other GI diseases given the demonstrated links between these diseases, Candida, inflammation, and dysbiosis. Among plant-derived compounds, phenolics, which encompass structural variants of flavonoids, hydroxybenzoic acids, hydroxycinnamic acids, coumarins, stilbenes, ellagitannins, and lignans can modify the composition of the gut microbiota (23, 24). The prebiotic potential of licorice root extracts has been evidenced in vitro (24, 25). Recent findings suggest that licorice (Glycyrrhiza uralensis Fisch.) could correct overall gut microbial dysbiosis and fecal metabolic disorders associated with CPT-11-induced colitis in mice (26). Compounds known to be present in walnut leaves, e.g., hydroxycinnamic acids and flavonoids, have also been reported to modulate gut microbiota composition (23, 24, 27).

Although many studies showed the in vitro antifungal effect against Candida sp. of licorice root extract and compounds (10, 1416), only a few in vivo studies demonstrate its effect on candidiasis (11, 12, 17). Concerning walnut leaf, its antimicrobial effect was only demonstrated in in vitro assays (1821). The objective of this study was to evaluate in vivo antifungal effects of specific hydroethanolic extracts of a walnut leaf (walnut leaf extract [WLE]) and licorice root (licorice root extract [LRE]), both separately and particularly in combination, in mice with GI candidiasis with the intention also to investigate whether the observed effects could involve anti-inflammatory activity and modulation of gut microbiota.

RESULTS

Phytochemical analysis of LRE revealed the presence of glycyrrhizin and several other compounds.

High-performance thin-layer chromatography (HPTLC) analyses identified both glycyrrhizic acid (glycyrrhizin) and formononetin in LRE (Fig. 1). Ultra-high-performance liquid-chromatography–tandem mass spectrometry (UHPLC-MS) analysis (Fig. 2 and Table 1) confirmed the presence of glycyrrhizic acid (Fig. 2, peak 13) in LRE and identified enoxolone (glycyrrhetinic acid; peak 23). Various other acids, including citric acid (peak 3) and p-hydroxy benzyl malonic acid (peak 4) were also identified as well as flavonoids, such as liquiritin apioside and isoliquiritin apioside (peaks 6 and 6’), licuroside (peak 8), isoviolanthin (peak 5), 3-hydroxyglabrol (peak 21), and glabrol (peak 22).

FIG 1.

FIG 1

High-performance thin-layer chromatography (HPTLC) analysis. Track 1: Extract of ground roots of Glycyrrhiza glabra (2 μL); track 2: licorice root extract (LRE) (2 μL); track 3: Glycyrrhizic acid (2 μL); track 4: Extract of ground roots of G. glabra (2.5 μL); track 5: LRE (2.5 μL); track 6: Formononetine (5 μL); track 7: Extract of ground roots of G. glabra (2 μL); track 8: LRE (2 μL).

FIG 2.

FIG 2

Liquid chromatography-mass spectrometry (LC-MS) analysis in negative ionization mode.

TABLE 1.

Compounds identified by liquid chromatography-mass spectrometry (LC-MS) in negative ionization mode

No. tR Compound Formula Mass Ion m/z M-H theoretical M-H (MS) M-H (MS/MS) Reference M-H standard or ref (MS/MS)
1 3.2 Glucose C6H12O6 180.06339 179.0561 179.0555 (179)59/71/89/113/101/85 (51) (179)59/89/71/119/101/113/85
2 4.37 Sucrose C12H22O11 324.11621 341.1089 341.1088 (341)89/59/71/119/179/113/
101/161/143/131
(52) (341)71/89/101/179/59/113/119/161/85/143/131
3 6.71 Citric acid C6H8O7 192.0270 191.0197 191.0186 (191)111/87/85/129/57/113/173 Standard (191)111/87/85
4 13.38 HBMA (p-hydroxybenzylmalonic acid) C10H10O5 210.0528 209.0455 209.0450 (209)165/121/59/121/93 (53) 165/121
5 16.42 Isoviolanthin C27H30O14 578.16356 577.1563 577.1566 (577)383/353/457/297/413 (54, 55) for fragmentation 457/503/473/559/383
6 and 6’ 17.90 and 27.97 Liquiritin apioside or Isoliquiritin apioside C26H30O13 550.16864 549.1614 549.1617
549.1617
(549)255/135/119/
429/153/417/297
(53, 56) for fragmentation 255/429/297/417
7, 7’, 7’’, 7’’’ 18.1, 18.6, 30.4, 32.21 Neoliquiritin or Liquiritin or Isoliquiritin C21H22O9 418.12638 417.1191 417.1196
417.1193
(417)255/135/119/153/148 (53, 57) for fragmentation 135/119/255
8 29.56 Licuroside C26H30O13 550.16864 549.1614 549.1618 (549)255/135/119/153/417/297 (53) 255/429/297/417
9 31.37 4′,7-dihydroxyflavone C15H10O4 254.05791 253.0506 253.0504 (253)117/135/133/153/91/209 (58) 252/135/117
10 33.68 Licochalcone B C16H14O5 286.08412 285.0768 285.0770 Positive (287)121/245/193/
107/147/139
(59) positive 255/193/165/121/93
11 and 11’ 35.45 and 46.06 Liquiritigenin or Isoliquiritigenin C15H12O4 256.07356 255.0663 255.0661 (255)119/135/153/91 (53, 60) (255)213/161/153/135/91
12 41.56 Licoricesaponin J2 C42H64O16 824.41944 823.4122 823.4131 (823)351/113/193/85/71/
72/75/59/175/99/289/
647/761/235/333/
307/471/805/261
(54) 805/779/761/647/539/351/333/289
13 42.91 Licoricesaponin A3 C48H72O21 984.45661 983.4493 983.4503 (983)351/113/821/193/85/71/72/75/59/99/645/803/289/627/235/759/469 (54) 923/863/821/803/760/645/351/289
14 43.46 Naringenin C15H12O5 272.06847 271.0612 271.0614 (271)151/119/107/
177/93/83/65
Standard (579)271/151/459/119/177/107/235/316
15 44.03 24-hydroxyglycyrrhizin C42H62O17 838.3987 837.3914 837.3920
837.3918
837.3922
837.3922
(837)351/113/193/85/175/71/
75/99/103/289/485/661
(61) 819/781/776/>775/704/661/
644/485/351/333/289
16 46.48 Glycyrrhizin
(glycyrrhizic acid)
C42H62O16 822.40379 821.3965 821.3973
821.3971
(821)351/113/193/85/175/71/72/75/59/99/103/ (53, 62) for fragmentation (821)351 /113 /193
17 46.96 Formononetin C16H12O4 268.07356 267.0663 267.0664 (267)252/223/132/208/195 (54) Standard for fragmentation (267)252/223/132/195
18 53.30 Glabridin C20H20O4 324.13616 323.1289 323.1288 (323)/135/201/109/
121/175/187/147/213
(53, 63) for fragmentation 135/201/21/121/147
19 53.38 Glabrone C20H16O5 336.09977 335.0925 335.0925 (335)291/213/135/199 (54, 64) for fragmentation 291/320/213/292/307
20 54.81 Kanzonol Y C25H30O5 410.20932 409.2020 409.2022
409.2020
(409)235/177/217/205/216/
189/191/161/391
(54) 405/391/365/235/217
21 56.06 3-hydroxyglabrol C25H28O5 408.19367 407.1864 407.1864 (407)235/177/216/205/161/389/233/229 (65) 201/185/177/161/349/215
22 57.12 Glabrol C25H28O4 392.19876 391.1915 391.1919 (391)187/203/221/
132/159
(66) for fragmentation 203/187/159
23 57.39 Enoxolone (glycyrrhetinic acid) C30H46O4 470.33961 469.3323 469.3324 (469)425/355 (53, 67) for fragmentation (469)425/355

LRE and WLE effectively reduced fecal colonization and gastrointestinal C. albicans infection in mice.

To characterize the efficacy of plant extracts on the outcome of GI candidiasis, we evaluated the susceptibility of mice to Candida GI infection after oral administration of LRE and WLE separately or in combination (Fig. 3A).

FIG 3.

FIG 3

Effect of licorice root extract (LRE) and walnut leaf extract (WLE) alone or combined on the outcome of gastrointestinal candidiasis. (A) Experimental procedure. LRE and WLE were administered orally, separately (2.5 g/kg) or in combination (1.25 + 1.25 g/kg), once daily for 12 days before C. albicans infection and then for 5 days after infection. Esophageal and gastrointestinal candidiasis was established by gavage of C. albicans (n = 10 per group). Stools were collected daily from day 3 to 5 after infection to quantify viable C. albicans. After 5 days of infection, the mice were sacrificed and the esophagus, cecum, and colon were aseptically removed to evaluate C. albicans colonization, microbiota composition, and inflammatory status. (B) Numbers of viable C. albicans were determined by colonies forming unit (CFU) enumeration in stools collected 3, 4, and 5 days postinfection. (C) On day 5 postinfection, mice were sacrificed and C. albicans colonization in the esophagus, cecum, and colon were assayed by quantitative RT-PCR. Data are presented as means ± SEM. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.005; ****, P ≤ 0.001 compared to Vehicle. #, P ≤ 0.05; ##, P ≤ 0.01; ###, P ≤ 0.005; ####, P ≤ 0.001 compared between treatments.

We first evaluated the number of viable Candida in the stool that reflects both the colonization of the GI tract and the spontaneous yeast elimination following Candida oral administration. In accordance with a longer delay between Candida inoculation in mice and the day of the analysis of the fungal load in the stool, the number of viable yeast at day 5 compared to day 3 and day 4 postinfection was decreased (Fig. 3B).

When the two extracts were administered separately, although WLE tended to decrease the number of viable C. albicans in the feces from day 3 to day 4, only LRE achieved a significant decrease from day 3 to 5 postinfection. Interestingly, when the two plant extracts were administered together the number of viable C. albicans in the feces was substantially decreased from day 3 to 5 postinfection (Fig. 3B). The C. albicans loads in the esophagus, cecum, and colon at day 5 were significantly diminished in mice treated with LRE or WLE separately or in combination (Fig. 3C). Although WLE had no impact on the amount of Candida in the stool, the Candida colonization of the esophagus, cecum, and colon were significantly reduced at day 5 postinfection (Fig. 3C). Altogether, these results demonstrate that oral administration of LRE and/or WLE favors the clearance of C. albicans throughout the GI tract.

Oral administration of LRE, WLE separately or in combination influenced the composition of the colonic mucosa-associated microbiota in mice subjected to GI candidiasis.

We evaluated the composition of colonic mucosa-associated bacteria in mice subjected to GI candidiasis that was treated with LRE, WLE, or the combination. Although the content of colonic mucosa-associated bacteria as a whole and that of the phylum Firmicutes were unaffected by LRE and WLE administered separately or in combination (Fig. 4A), the abundance of protective bacteria such as Bifidobacterium spp. and Faecalibacterium prausnitzii increased after administration of the two extracts combined. In line with this observation, the administration of LRE and WLE in combination tended to increase the content of Lactobacillus spp and L. murinus, which is described as a key beneficial bacteria for the health of the intestinal mucosa (28, 29). At the same time, LRE and WLE separately or in combination significantly reduced Bacteroidetes and Clostridium spp. loads, which are often increased in dysbiosis. The content of Enterobacteriaceae was unaffected by the extracts (Fig. 4B). Thus, the LRE/WLE combination significantly shifted the composition of gut microbiota toward a protective profile.

FIG 4.

FIG 4

Effect of oral administration of licorice root extract (LRE) and walnut leaf extract (WLE) alone or in combination on the colon mucosa-associated microbiota of C. albicans-infected mice. The relative abundance of (A) protective and (B) pathobiont phyla and bacteria species in the colonic mucosa of C. albicans-infected mice treated with the LRE and WLE alone or in combination or with the vehicle (n = 10 mice per group) was evaluated by RT-PCR. Values were normalized to total bacteria and host β-actin. Data are presented as means ± SEM. *, P ≤ 0.05; **, P ≤ 0.01 compared to vehicle. #, P ≤ 0.05 compared between treatments.

Oral administration of LRE and WLE separately or in combination reduced gut inflammation and improved the oxidative status of colonic tissues of C. albicans-infected mice.

To investigate the effect of LRE and WLE alone or in combination on colonic inflammation in mice infected with C. albicans, we assessed the expression of proinflammatory and anti-inflammatory markers in colonic tissues. Administration of the plant extracts separately or in combination decreased proinflammatory gene expression (Il12p40, Tnfa, Il1b, Crp, Ccl2). Interestingly, the combination of the two extracts induced a more robust decline in the expression of proinflammatory genes than either extract administered separately (Fig. 5A). These findings were corroborated by the reciprocal increase in the expression of IL-10 and TGF-β1 anti-inflammatory cytokines in colonic tissues of C. albicans-infected mice that received the plant extracts (Fig. 5B).

FIG 5.

FIG 5

Modulation of colonic inflammatory and oxidative status of C. albicans-infected mice treated with licorice root extract (LRE) and walnut leaf extract (WLE) alone or in combination. LRE and WLE alone or in combination, or vehicle were orally administered to mice (n = 10 per group) for 12 days. After this treatment, mice were orally infected with C. albicans and sacrificed 5 days later. Total RNAs isolated from the colon were subjected to the RT-PCR analysis using specific primer sets for (A) proinflammatory markers (Il12p40 [Interleukin-12p40], Tnfa [Tumour Necrosis Factor alpha], Il1b [Interleukin-1 beta], Crp [C-reactive protein], Ccl2 [C-C Motif Chemokine Ligand 2]), (B) for anti-inflammatory cytokines (il10 [Interleukin-10], Tgfb1 [Transforming Growth Factor Beta 1], il1ra [Interleukin-1 receptor antagonist]), (C) for enzymes involved in the production of pro- or anti-inflammatory eicosanoids (Ptgs2 [cyclooxygenase-2], Pges [prostaglandin E synthase], Lta4h [LTB4 hydrolase], Hpgds [prostaglandin D synthase], Alox15 [12/15-lipoxygenase]), (D) for pro-oxidant enzymes (p47phox [a cytosolic subunit of the NADPH oxidase complex], Nos2 [inducible nitric oxide synthase]), and (E) for enzymes involved in anti-oxidant activities (Arg1 [arginase-1], Sod2 [superoxide dismutase], Hemox-1 [hemoxygenase 1], Nqo1 [NADPH quinone dehydrogenase 1], Cat [catalase-1]). Data are presented as means ± SEM. *, P ≤ 0.01; **, P ≤ 0.01; ***, P ≤ 0.005; ****, P ≤ 0.001 compared to vehicle. #, P ≤ 0.05; ##, P ≤ 0.01 compared between treatments.

Consistent with the decrease in proinflammatory markers induced, the LRE/WLE combination also decreased the mRNA expression of enzymes involved in the synthesis of proinflammatory eicosanoids (Ptgs2 [cyclooxygenase-2], Pges [prostaglandin E synthase] and LTA4h [LTB4 hydrolase], a critical enzyme for synthesis of the proinflammatory mediator LTB4) (Fig. 5C). The mRNA expression of enzymes involved in the synthesis of anti-inflammatory eicosanoids (Hpgds [prostaglandin D synthase] and Alox15 [12/15-lipoxygenase]) was not affected by administration of the plant extracts (Fig. 5C).

Regarding the oxidative stress status of the colon, the mRNA expression of p47phox, a cytosolic subunit of the NADPH oxidase complex, and the expression of inducible nitric oxide synthase (Nos2), the activation of which is essential for the release of reactive oxygen species (ROS), were downregulated in response to the plant extracts with a stronger effect when the two extracts were combined (Fig. 5D). In accordance with this reduced oxidative status, the LRE/WLE combination shifted the balance between Nos2 and arginase-1 toward the expression of arginase-1 (Fig. 5D and E). Moreover, although administration of the LRE/WLE combination slightly decreased Sod2 (superoxide dismutase) and Hemox-1 (hemoxygenase 1) concentrations, the combination significantly increased expression of the antioxidant enzymes Nqo1 (NADPH quinone dehydrogenase 1), Cat (catalase-1) and Arg1 (arginase-1) (Fig. 5E).

Altogether, these data highlight the anti-inflammatory and antioxidant potential of the LRE/WLE combination in the colon during gastrointestinal infection with C. albicans.

DISCUSSION

Although Candida spp. form part of the commensal microbiota in most individuals with a healthy immune system, variations in the local microenvironment, antibiotic treatment, or alterations in the immune system can favor dysbiosis and rapid proliferation of Candida, which can then become a pathogen (1, 2). The high incidence of fungal infections caused by Candida species and their increasing resistance to antimicrobial treatments, stimulate alternative approaches and new prophylactic therapies.

In the present study, we evaluated the effects of hydroethanolic extracts of licorice root (LRE) and walnut leaf (WLE), administered separately or in combination, on GI colonization by C. albicans, colon inflammation, and gut microbiota composition in mice. We observed that the level of C. albicans in the feces and colonization of the GI tract of infected mice treated with the plant extracts were significantly reduced. Interestingly, the two plant extracts administered together substantially decreased the number of viable C. albicans in the feces as well as the Candida burden in the esophagus, cecum, and colon, suggesting that the combination administered orally has synergistic effects and favors the clearance of C. albicans from the GI tract. In previous studies, licorice root extracts and specific compounds have consistently been shown to play a protective role against candidiasis in mice, owing to their ability to modulate the immune system and possibly to their prebiotic effects (1115, 17, 2426). Glycyrrhizin administered to mice inoculated with C. albicans at lethal doses decreased the mortality rate by 35%, increased mean survival time from 7 to 11 days, and decreased symptom severity (11). These effects were supported by the results of a study in MAIDS mice, which exhibit a 100 times greater susceptibility to C. albicans infection than wild-type mice, demonstrating the potential of glycyrrhizin to increase their resistance against C. albicans infection (12). In mice immunized with a C. albicans surface mannan extract in emulsion form, 18β-glycyrrhetinic acid (aglycone of glycyrrhizin) exerted a dominant Th1-immunological adjuvant effect (13). In vitro, this component also inhibited the growth of C. albicans isolated from patients with recurrent vulvovaginal candidiasis (14). Several additional studies have demonstrated the value of other licorice root compounds in fungal infections (13, 1517). In vitro, the chalcone licochalcone A and the isoflavonoid glabridin showed antifungal activity against C. albicans (15). Licochalcone A had a significant inhibitory effect on biofilm formation, a key virulence factor, while both licochalcone A and glabridin inhibited the yeast-hyphae transition (15). Glabridin was also shown to induce C. albicans apoptosis via the caspase-independent route (16). Liquiritigenin, a flavonoid, increased the survival time of mice infected with C. albicans, this licorice root component protecting the mice against disseminated candidiasis by a CD4+ Th1 immune response (17).

Thus, the observed antifungal properties of the licorice root extract (LRE) evaluated in the present study could be due to the presence of flavonoids, such as glabridin and liquiritigenin, and to the presence of glycyrrhizic acid (and its derivative glycyrrhetinic acid), identified by UHPLC-MS analysis, and known to increase the resistance of mice to C. albicans infection (12, 13).

As we previously reported, the WLE tested contains several flavonoids, including quercetin, myricetin, kaempferol, and taxifolin derivatives as well as hydroxycinnamic acids (30). In a recent study, an extract of Trachyspermum ammi seeds enriched in rosmarinic acid-3-O-glucopyranoside, as well as kaempferol-(coumaroyl glucosyl)-rhamnoside and quercetin-3-O-galactoside, inhibited Candida in vitro (31). The anti-fungal effects of quercetin alone have been demonstrated in other in vitro studies (32, 33). It was reported that the regulation of quorum sensing by quercetin, isolated from an edible lichen (Usnea longissima), could sensitize resistant C. albicans to fluconazole and thereby enhance the efficacy of this drug. Quercetin enhanced the destruction of C. albicans NBC099 cells by fluconazole and induced cell death. It was also found to strongly suppress the onset of virulence-enhancing processes such as biofilm formation and hyphal development, as well as phospholipase, proteinase, esterase, and hemolytic activities. The sensitization was dependent on the farnesol response generated by quercetin, farnesol being a quorum-sensing compound produced by C. albicans, that is known to regulate the expression of Candida virulence factors. In addition, taxifolin was identified as an inhibitor of the transcriptional factors (Tec1 and Rfg1) inducing the hyphal growth responsible for the invasiveness and virulence of C. albicans (34).

As microbiota composition of the GI tract influences the evolution of Candida from a commensal to a pathogenic status and that licorice and walnut are described to have prebiotic effects (2327, 35), we evaluated the effect of LRE and WLE on colonic microbiota in mice with GI candidiasis. Our data indicate a correlation between LRE and WLE supplementation and a shift within the gut microbiome toward a protective profile. The relevant increase in protective bacteria, such as Bifidobacterium spp. and Faecalibacterium prausnitzii, known to have probiotic and anti-inflammatory properties (3639), following oral administration of the extracts in combination as well as the decrease in pathobionts, such as Clostridium spp., support a synergic effect of the two extracts. These findings suggest that regular supplementation may provide prebiotic benefits by modifying the composition and diversity of the gut microbiota in such a way as to counteract Candida growth.

In line with its antimicrobial properties inhibiting Candida colonization of the GI tract and the reorientation of the colonic mucosal microbiota toward protective bacteria, the combination of the two plant extracts also alleviated colonic inflammation. We demonstrated that the Candida burden was greatly diminished by the combination, a finding consistent with the higher reduced colonic inflammation. In line with the anti-inflammatory activity of the combination, several components of licorice, including glycyrrhizic acid and isoliquiritigenin, which were detected in our extract, have been reported to have anti-inflammatory, antioxidant and GI tract protective effects (4043). Likewise, walnut extract exhibits anti-inflammatory activities through nonchlorogenic and chlorogenic acids known for their antioxidant and anti-inflammatory activities (30, 4446).

Interestingly, the two plant extracts combined presented a synergistic anti-inflammatory effect related to a greater reduction of proinflammatory cytokines and enzymes involved in the synthesis of proinflammatory eicosanoids. Concomitantly, the two plant extracts combined strongly induced the expression of anti-inflammatory cytokines. Furthermore, this combination showed a stronger antioxidant potential resulting from the downregulation of p47phox, Nos2, and the upregulation of antioxidant enzymes in the colonic tissue of infected mice.

Altogether, our results suggest that the two plant extracts combined effectively control GI candidiasis and the associated gut inflammation through their anti-inflammatory and antioxidant properties, and their ability to modulate the composition of the gut microbiota.

This study highlights the significant prebiotic potential of the LRE/WLE combination and suggests that the health benefits of these plant extracts are due, at least in part, to their ability to modulate the gut microbiota, reduce inflammation, and oxidative stress, and protect against opportunistic infection.

MATERIALS AND METHODS

Hydroethanolic extracts of licorice root and walnut leaf.

In this study, we evaluated hydroethanolic extracts of licorice (Glycyrrhiza glabra L.) roots and walnut (Juglans regia L.) leaves provided by PiLeJe Laboratoire. The preparation and phytochemical analysis of the hydroethanolic extract of walnut leaves was previously published (30). Briefly, a hydroethanolic extract of fresh walnut leaves (walnut leaf extract [WLE]; PL-NOY-01; PiLeJe Laboratoire, France) was obtained according to a process similar to that used for the licorice root extract described in detail below. In this previously published study, chromatographic analyses had revealed the presence of various flavonoids (including quercetin, myricetin, kaempferol, and taxifolin derivatives) as well as hydroxycinnamic acids (including neochlorogenic acid).

Preparation of the hydroethanolic licorice root extract.

Licorice (Glycyrrhiza glabra L.) roots were collected in Spain in November 2017. Fresh licorice roots were extracted by 20% to 70% (vol/vol) ethanolic leaching. The extracts were then mixed and concentrated under reduced pressure (100-pascal absolute pressure) at controlled temperature (35 to 45°C). Glycerol was then added to dilute the resulting extract to a final concentration of 5.2% (wt/wt) (referred to as licorice root extract [LRE]; PL-REG-01; PiLeJe Laboratoire, France).

HPTLC analysis of the LRE.

Standards were diluted in ethanol 70% at a concentration of 0.4 mg/mL for glycyrrhizic acid and in methanol 0.1 mg/mL for formononetin. The LRE without glycerol (1 mL) was diluted in 3 mL of a mixture of ethanol and water (70/30 vol/vol). The resultant solution was shaken and centrifuged for 5 min at 4400 rpm. The supernatant solution was transferred into individual vials and then submitted for HPTLC analysis. In addition,1.8 g of ground licorice roots was extracted with 20 mL of ethanol and water (70/30 vol/vol). The resultant solution was sonicated for 10 min and centrifuged for 5 min at 4400 rpm. The supernatant solution was transferred into individual vials and then subjected to HPTLC analysis.

HPTLC analysis was performed on 200.0 × 100.0 mm silica gel 60 F 254 HPTLC glass plates (Merck, Germany). Standard solutions and samples were applied to the plate as 6.0 mm wide bands using CAMAG Automatic TLC sampler (ATS 4). The equipment comprised a CAMAG horizontal developing chamber, a TLC plate heater, a CAMAG Derivatizer Device, a CAMAG chromatogram immersion device, a CAMAG visualizer, and VisionCATS software. The general chromatography conditions are presented in Table 2.

TABLE 2.

General chromatography conditions for HPTLC analysis of the licorice root extract

Parameters Amino acids Glycyrrhizic acid Flavonoids and phenolic acids
Distance from lower edge 5 mm 8 mm 5 mm
Distance from left and right edges 15 mm 20 mm 15 mm
Space between bands 8.4 mm 12 mm 8 mm
No. of tracks 21 6 22
Development distance from lower edge 50 mm 70 mm 50 mm
Mobile phase Butanol, acetone, acetic acid, water (3.5/3.5/1/2) with 40.9 mg of ninhydrin Ethyl acetate/acetic acid/formic acid/water (30/2/2/4) Ethyl acetate/acetic acid/formic acid/water (50/5.5/5.5/13)
Derivatization conditions 100°C for 3 min Spraying (nozzle: yellow, level:4) with 3 mL of 10% sulfuric acid and heating to 100°C for 10 min 110°C for 10 min and dipping (speed: 5, time: 0) with natural product reagent then polyethylene glycol reagent
Visualization White light White light UV light at 366 nm

LC/MS analysis of the LRE.

Chromatographic analyses (UHPLC) were performed on an Ultimate 3000 RSLC UHPLC system (Thermo Fisher Scientific Inc., MA, USA) coupled to a binary pump (U3000 HPG-3400RS) and a diode array detector. Compounds were separated on an Uptisphere Strategy C18 column (25 × 4.6 mm; 5 μm; Interchim), which was controlled at 40°C. The mobile phase was a mixture of 0.1% (vol/vol) formic acid in water (phase A) and 0.1% (vol/vol) formic acid in acetonitrile (phase B). The gradient of phase A was 100% (0 min), 80% (10 min), 73% (35 min), 30% (50 min), 0% (55 min). The flow rate was 0.8 mL/min, and the injection volume was 5 μL. The UHPLC system was connected to a Q-Exactive Orbitrap (Thermo Fisher Scientific Inc., MA, USA) mass spectrometer, operated in negative and positive electrospray ionization mode. Source operating conditions: 3 kV spray voltage for negative mode and 3.5 kV spray voltage for positive mode; 320°C heated capillary temperature; 475°C auxiliary gas temperature; sheath, sweep, and auxiliary gas (nitrogen) flow rate 60, 18, and 4 arbitrary units, respectively; and collision cell voltage between 20 and 50 eV. Full scan data were obtained at a resolution of 35,000 whereas MS2 data were obtained at a resolution of 17,500. Data were processed using Xcalibur software (Thermo Fisher Scientific Inc., MA, USA).

Compounds present in the LRE were characterized according to their retention times, mass spectral data, and comparison with authentic standards when available or with published data.

Murine model of gastrointestinal candidiasis.

All mouse experiments were performed according to protocols approved by the institutional ethics committee (CEEA122) and the French Ministry of Higher Education, Research, and Innovation (ESRI) under permit number 5412–2016051917498658;2016 to 2020 and renewed under permit number 23558–2020011016561848;2020 to 2025 in accordance with European legal and institutional guidelines (2010/63/UE) for the care and use of laboratory animals. Female C57BL/6 mice aged 8 weeks were purchased from Janvier Labs (France). LRE and WLE were administered orally, separately (2.5 g/kg) or in combination (1.25 + 1.25 g/kg), once daily for 12 days before C. albicans infection and then 5 days after infection. Control groups received only the vehicle (saline solution diluted with glycerol to the same extent as the extracts). Esophageal and GI candidiasis was established by intraesophageal administration of C. albicans at the rate of 50 × 106 blastospores in sterile saline solution per mouse, as described previously (47, 48). Ten mice were included in each experimental group. Stools were collected daily from day 3 to day 5 after infection to quantify viable C. albicans. After 5 days of infection, the mice were sacrificed and the esophagus, cecum, and colon were aseptically removed to evaluate C. albicans colonization, microbiota composition, and inflammatory status.

Preparation and quantification of viable C. albicans in stools.

The strain of C. albicans used throughout these experiments (sc-5314) was provided by the American Type Culture Collection (ATCC) and was maintained on Sabouraud dextrose agar (SDA; Bio-Rad, Hercules, CA, USA) plates containing gentamicin and chloramphenicol. Growth from an 18 to 24 h SDA culture of C. albicans was suspended in sterile saline solution (NaCl 0.9%) for mice infection (49, 50).

Stools were collected daily from day 3 to day 5 after infection, weighed, and mechanically homogenized in phosphate buffer saline (PBS). Serial dilutions of homogenates were plated on SDA plates containing gentamicin and chloramphenicol for the quantitative determination of the number of C. albicans. Plates were incubated at 37°C for 24 h and the number of colonies was counted to determine the colonies forming unit (CFU)/g of stool.

Quantification of C. albicans in the gastrointestinal tract and microbiota analysis using real-time PCR.

The esophagus, cecum, and colon dissected from infected mice were crushed using lysing matrix tubes (MP Biomedicals, Illkirsh, France). Tissue sample homogenates were resuspended in BLB lysis buffer (Roche Diagnostics, Meylan, France) for 20 min at room temperature and DNA was purified using a High Pure PCR Template Preparation kit (Roche). RT-PCR was performed on a Light Cycler 480 system using Light Cycler SYBR Green I Master (Roche). For amplicon detection, the Light Cycler DNA SYBR green I kit was used as described by the manufacturer (Roche Diagnostics, Meylan, France). The primers used are listed in Table 3.

TABLE 3.

Primers used for gut microbiota analysis (68)

Gene 5′–3′ universal name 5′–3′ sequence
Candida spp. (69) sense TCGCATCGATGAAGAACGCAGC
antisense TCTTTTCCTCCGCTTATTGATATGC
Clostridium spp. (28) sense CGGTACCTGACTAAGAAGC
antisense AGTTTYATTCTTGCGAACG
Bifidobacterium spp. (28) sense GGGTGGTAATGCCGGATG
antisense TAAGCGATGGACTTTCACACC
Lactobacillus spp. (28) sense AGCAGTAGGGAATCTTCCA
antisense CACCGCTACACATGGAG
Total bacteria (29) sense Eub338F ACTCCTACGGGAGGCAGCAG
antisense Eub518R ATTACCGCGGCTGCTGG
Bacteroidetes (29) sense Bact934F GGARCATGTGGTTTAATTCGATGAT
antisense Bact1060R AGCTGACGACAACCATGCAG
Firmicutes (29) sense Firm934F GGAGYATGTGGTTTAATTCGAAGCA
antisense Firm1060R AGCTGACGACAACCATGCAC
Enterobacteriaceae (70) sense Uni515F GTGCCAGCMGCCGCGGTAA
antisense Ent826R GCCTCAAGGGCACAACCTCCAAG
F. prausnitzii (71) sense Fprau223F GATGGCCTCGCGTCCGATTAG
antisense Fprau420R CCGAAGACCTTCTTCCTCC
L. murinus/animalis (72) sense TCGAACGAAACTTCTTTATCACC
antisense ATGACCCAGATCATGTTTGA
Genomic actin (73) sense ATGACCCAGATCATGTTTGA
antisense TACGACCAGAGGCATACAG

To quantify the number of Candida, C. albicans cell suspensions were standardized at 106 cells/mL and serially diluted samples of genomic fungal DNA (range: 100 to 106 cells/mL) were used as external standards in each run. Cycle numbers of the logarithmic linear phase were plotted against the logarithm of the concentration of template DNA to evaluate the number of yeasts present in each tissue sample homogenate and normalized to the amount of genomic β-actin.

Semiquantitative RT-PCR was performed with primers that amplify the genes encoding 16S rRNA from specific bacterial groups on DNA isolated from colonic mucosa to evaluate mucosa-associated bacteria colonization. Relative quantity was calculated and normalized to the amount of genomic β-actin.

Gene expression analysis by reverse transcription and real-time PCR.

mRNA from colonic tissues were prepared and cDNA was synthesized according to the manufacturer’s recommendations (Total RNA Minipreps super kit, BioBasic; Verso cDNA kit, Thermo Fisher Scientific). RT-PCR was performed on a Light Cycler 480 system with Light Cycler SYBR Green I Master Mix (Roche). Serially diluted samples of pooled cDNA were used as external standards in each run for the quantification. GAPDH was used as the housekeeping gene. The primers (Eurogentec), designed with the software Primer 3, were listed in Table 4.

TABLE 4.

Primer sequences used in qRT-PCR

Gene 5′–3′Sequence Sequence
Alox15 sense GTTCAGGAACCACAGGGAGG
antisense GTCAGAGATACTGGTCGCCG
Arg1 sense CGTGTACATTGGCTTGCGAG
antisense TCGGCCTTTTCTTCCTTCCC
Cat sense ACATGGTCTGGGACTTCTGG
antisense CAAGTTTTTGATGCCCTGGT
CCL2 sense AGGTCCCTGTCATGCTTCTG
antisense TCTGGACCCATTCCTTCTTG
Crp sense CGCAGCTTCAGTGTCTTCTC
antisense AGATGTGTGTTGGAGCCTCA
Gapdh sense ACACATTGGGGGTAGGAACA
antisense AACTTTGGCATTGTGGAAGG
Hemox-1 sense CACGCATATACCCGCTACCT
antisense CCAGAGTGTTCATTCGAGCA
Hpgds sense GGACACGCTGGATGACTTCA
antisense TCCCAGTAGAAGTCTGCCCA
Il10 sense AGGCGCTGTCATCGATTTCT
antisense GCTCCACTGCCTTGCTCTTA
Il12p40 sense AGGTCACACTGGACCAAAGG
antisense TGGTTTGATGATGTCCCTGA
Il1ra sense GGCCTAGGTGTCTTCTGCTC
antisense GTAAGGGAGTCACTTGGGGC
Il1b sense CAACCAACAAGTGATATTCTCGATG
antisense GATCCACACTCTCCAGCTGCA
Lta4h sense GTTGACAGCTGAACCCCAGT
antisense CGTGCCCTTAGTTCCACATT
Nos2 sense TCCTGGACATTACGACCCCT
antisense ACAAGGCCTCCAATCTCTGC
Nqo1 sense TTCTCTGGCCGATTCAGAGT
antisense GGCTGCTTGGAGCAAAATAG
Pges sense CCTAGGCTTCAGCCTCACAC
antisense CAGCCTATTGTTCAGCGACA
Ptgs2 sense AGAAGGAAATGGCTGCAGAA
antisense GCTCGGCTTCCAGTATTGAG
p47phox (Ncf1) sense AGTGATGCGGAGACTTTGCT
antisense ACCGGAGTTACAGGCAAATG
Sod2 sense GCCCCCTGAGTTGTTGAATA
antisense AGACAGGCAAGGCTCTACCA
Tgfb1 sense AGGTTGGCATTCCACTTCAC
antisense AGGGGCCTCTAAGAGCAGTC
Tnfa sense AGCCCCCAGTCTGTATCCTT
antisense CTCCCTTTGCAGAACTCAGG

Statistical analysis.

GraphPad Prism (GraphPad Software, Inc., La Jolla, CA, USA) was used for graph preparation and statistical evaluation. Differences between groups were assessed using ANOVA, followed by a nonparametric Mann-Whitney test. Differences with P ≤ 0.05 were considered significant (*, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ****, P ≤ 0.0001). Data represent mean values ± standard error of the mean (SEM).

ACKNOWLEDGMENTS

This research was funded by PileJe Laboratoire, Paris, France. We thank Philippe Batigne (RESTORE UMR 1301-Inserm 5070-CNRS EFS Université P. Sabatier, Toulouse, France) for technical support in the animal studies.

Conceptualization and methodology: A.C., S.H.; formal analysis and investigation: H.A., V.B., L.B., B.B.; writing - original draft preparation: H.A., C.B.; writing - reviewing, and editing, H.A., C.B., A.C., S.H.

V.B., L.B., C.B., and S.H. are employees of PiLeJe and were involved in the design, investigation, writing of the manuscript, and decision to publish.

Contributor Information

Hélène Authier, Email: helene.authier@univ-tlse3.fr.

Sophie Holowacz, Email: s.holowacz@pileje.com.

Agnès Coste, Email: agnes.coste@univ-tlse3.fr.

Renato Kovacs, University of Debrecen.

REFERENCES

  • 1.Dadar M, Tiwari R, Karthik K, Chakraborty S, Shahali Y, Dhama K. 2018. Candida albicans - Biology, molecular characterization, pathogenicity, and advances in diagnosis and control - An update. Microb Pathog 117:128–138. doi: 10.1016/j.micpath.2018.02.028. [DOI] [PubMed] [Google Scholar]
  • 2.Pérez JC. 2019. Candida albicans dwelling in the mammalian gut. Curr Opin Microbiol 52:41–46. doi: 10.1016/j.mib.2019.04.007. [DOI] [PubMed] [Google Scholar]
  • 3.Kumamoto CA. 2011. Inflammation and gastrointestinal Candida colonization. Curr Opin Microbiol 14:386–391. doi: 10.1016/j.mib.2011.07.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Poulain D. 2015. Candida albicans, plasticity and pathogenesis. Crit Rev Microbiol 41:208–217. doi: 10.3109/1040841X.2013.813904. [DOI] [PubMed] [Google Scholar]
  • 5.Kowalska-Duplaga K, Krawczyk A, Sroka-Oleksiak A, Salamon D, Wędrychowicz A, Fyderek K, Gosiewski T. 2019. Dependence of colonization of the large intestine by Candida on the treatment of Crohn’s disease. Pol J Microbiol 68:121–126. doi: 10.21307/pjm-2019-014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li J, Chen D, Yu B, He J, Zheng P, Mao X, Yu J, Luo J, Tian G, Huang Z, Luo Y. 2018. Fungi in gastrointestinal tracts of human and mice: from community to functions. Microb Ecol 75:821–829. doi: 10.1007/s00248-017-1105-9. [DOI] [PubMed] [Google Scholar]
  • 7.Sokol H, Leducq V, Aschard H, Pham H-P, Jegou S, Landman C, Cohen D, Liguori G, Bourrier A, Nion-Larmurier I, Cosnes J, Seksik P, Langella P, Skurnik D, Richard ML, Beaugerie L. 2017. Fungal microbiota dysbiosis in IBD. Gut 66:1039–1048. doi: 10.1136/gutjnl-2015-310746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zida A, Bamba S, Yacouba A, Ouedraogo-Traore R, Guiguemdé RT. 2017. Anti-Candida albicans natural products, sources of new antifungal drugs: a review. J Mycol Med 27:1–19. doi: 10.1016/j.mycmed.2016.10.002. [DOI] [PubMed] [Google Scholar]
  • 9.de Maia CMA, Pasetto S, Nonaka CFW, de Costa EMMB, Murata RM. 2021. Yeast-host interactions: Anadenanthera colubrina modulates virulence factors of C. albicans and inflammatory response in vitro. Front Pharmacol 12:629778. doi: 10.3389/fphar.2021.629778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.de Oliveira JR, de Castro VC, das Graças Figueiredo Vilela P, Camargo SEA, Carvalho CAT, Jorge AOC, de Oliveira LD. 2013. Cytotoxicity of Brazilian plant extracts against oral microorganisms of interest to dentistry. BMC Complement Altern Med 13:208. doi: 10.1186/1472-6882-13-208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Guo N. 1991. Protective effect of glycyrrhizine in mice with systemic Candida albicans infection and its mechanism. Zhongguo Yi Xue Ke Xue Yuan Xue Bao 13:380–383. [PubMed] [Google Scholar]
  • 12.Utsunomiya T, Kobayashi M, Ito M, Pollard RB, Suzuki F. 2000. Glycyrrhizin improves the resistance of MAIDS mice to opportunistic infection of Candida albicans through the modulation of MAIDS-associated type 2 T cell responses. Clin Immunol 95:145–155. doi: 10.1006/clim.2000.4854. [DOI] [PubMed] [Google Scholar]
  • 13.Kim J, Joo I, Kim H, Han Y. 2013. 18β-glycyrrhetinic acid induces immunological adjuvant activity of Th1 against Candida albicans surface mannan extract. Phytomedicine 20:951–955. doi: 10.1016/j.phymed.2013.04.008. [DOI] [PubMed] [Google Scholar]
  • 14.Pellati D, Fiore C, Armanini D, Rassu M, Bertoloni G. 2009. In vitro effects of glycyrrhetinic acid on the growth of clinical isolates of Candida albicans. Phytother Res 23:572–574. doi: 10.1002/ptr.2693. [DOI] [PubMed] [Google Scholar]
  • 15.Messier C, Grenier D. 2011. Effect of licorice compounds licochalcone A, glabridin and glycyrrhizic acid on growth and virulence properties of Candida albicans. Mycoses 54:e801-806–e806. doi: 10.1111/j.1439-0507.2011.02028.x. [DOI] [PubMed] [Google Scholar]
  • 16.Moazeni M, Hedayati MT, Nabili M. 2018. Glabridin triggers over-expression of apoptosis inducing factor (AIF) gene in Candida albicans. Curr Med Mycol 4:19–22. doi: 10.18502/cmm.4.3.172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lee JY, Lee J-H, Park JH, Kim S-Y, Choi JY, Lee SH, Kim YS, Kang SS, Jang E-C, Han Y. 2009. Liquiritigenin, a licorice flavonoid, helps mice resist disseminated candidiasis due to Candida albicans by Th1 immune response, whereas liquiritin, its glycoside form, does not. Int Immunopharmacol 9:632–638. doi: 10.1016/j.intimp.2009.02.007. [DOI] [PubMed] [Google Scholar]
  • 18.Martins N, Ferreira ICFR, Barros L, Carvalho AM, Henriques M, Silva S. 2015. Plants used in folk medicine: the potential of their hydromethanolic extracts against Candida species. Industrial Crops and Products 66:62–67. doi: 10.1016/j.indcrop.2014.12.033. [DOI] [Google Scholar]
  • 19.Noumi E, Snoussi M, Hajlaoui H, Valentin E, Bakhrouf A. 2010. Antifungal properties of Salvadora persica and Juglans regia L. extracts against oral Candida strains. Eur J Clin Microbiol Infect Dis 29:81–88. doi: 10.1007/s10096-009-0824-3. [DOI] [PubMed] [Google Scholar]
  • 20.Çitoğlu GS, Altanlar N. 1955. Antimicrobial activity of some plants used in folk medicine: geleneksel tedavide kullanilan bazi bitkilerin antimikrobiyal aktivitesi. Ankara Universitesi Eczacilik Fakultesi Dergisi :159–163. doi: 10.1501/Eczfak_0000000409. [DOI] [Google Scholar]
  • 21.Pereira JA, Oliveira I, Sousa A, Valentão P, Andrade PB, Ferreira ICFR, Ferreres F, Bento A, Seabra R, Estevinho L. 2007. Walnut (Juglans regia L.) leaves: phenolic compounds, antibacterial activity and antioxidant potential of different cultivars. Food Chem Toxicol 45:2287–2295. doi: 10.1016/j.fct.2007.06.004. [DOI] [PubMed] [Google Scholar]
  • 22.Plamada D, Vodnar DC. 2021. Polyphenols-gut microbiota interrelationship: a transition to a new generation of prebiotics. Nutrients 14:137. doi: 10.3390/nu14010137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Loo YT, Howell K, Chan M, Zhang P, Ng K. 2020. Modulation of the human gut microbiota by phenolics and phenolic fiber-rich foods. Compr Rev Food Sci Food Saf 19:1268–1298. doi: 10.1111/1541-4337.12563. [DOI] [PubMed] [Google Scholar]
  • 24.Peterson CT, Sharma V, Uchitel S, Denniston K, Chopra D, Mills PJ, Peterson SN. 2018. Prebiotic potential of herbal medicines used in digestive health and disease. J Altern Complement Med 24:656–665. doi: 10.1089/acm.2017.0422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tsirulnichenko L, Kretova J. 2020. Prebiotic properties of licorice root extracts 652.6Kb.
  • 26.Yue S-J, Qin Y-F, Kang A, Tao H-J, Zhou G-S, Chen Y-Y, Jiang J-Q, Tang Y-P, Duan J-A. 2021. Total flavonoids of Glycyrrhiza uralensis alleviates irinotecan-induced colitis via modification of gut microbiota and fecal metabolism. Front Immunol 12:628358. doi: 10.3389/fimmu.2021.628358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Leonard W, Zhang P, Ying D, Fang Z. 2021. Hydroxycinnamic acids on gut microbiota and health. Compr Rev Food Sci Food Saf 20:710–737. doi: 10.1111/1541-4337.12663. [DOI] [PubMed] [Google Scholar]
  • 28.Carroll IM, Chang Y-H, Park J, Sartor RB, Ringel Y. 2010. Luminal and mucosal-associated intestinal microbiota in patients with diarrhea-predominant irritable bowel syndrome. Gut Pathog 2:19. doi: 10.1186/1757-4749-2-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. 2008. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Lett Appl Microbiol 47:367–373. doi: 10.1111/j.1472-765X.2008.02408.x. [DOI] [PubMed] [Google Scholar]
  • 30.Holowacz S, Blondeau C, Guinobert I, Guilbot A. 2016. Anti-diarrheal and anti-nociceptive effects of a hydroethanolic leaf extract of walnut in rats. Med Aromat Plants 5. doi: 10.4172/2167-0412.1000268. [DOI] [Google Scholar]
  • 31.Dutta S, Kundu A. 2021. Macroporous resin-assisted enrichment, characterizations, antioxidant and anticandidal potential of phytochemicals from Trachyspermum ammi. J Food Biochem e13847. doi: 10.1111/jfbc.13847. [DOI] [PubMed] [Google Scholar]
  • 32.Ozçelik B, Kartal M, Orhan I. 2011. Cytotoxicity, antiviral and antimicrobial activities of alkaloids, flavonoids, and phenolic acids. Pharm Biol 49:396–402. doi: 10.3109/13880209.2010.519390. [DOI] [PubMed] [Google Scholar]
  • 33.Ivanov M, Kannan A, Stojković DS, Glamočlija J, Calhelha RC, Ferreira ICFR, Sanglard D, Soković M. 2020. Flavones, flavonols, and glycosylated derivatives-impact on Candida albicans growth and virulence, expression of CDR1 and ERG11, cytotoxicity. Pharmaceuticals (Basel) 14:27. doi: 10.3390/ph14010027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mishra S, Singh S, Misra K. 2017. Restraining pathogenicity in Candida albicans by taxifolin as an inhibitor of Ras1-pka pathway. Mycopathologia 182:953–965. doi: 10.1007/s11046-017-0170-4. [DOI] [PubMed] [Google Scholar]
  • 35.Bamberger C, Rossmeier A, Lechner K, Wu L, Waldmann E, Fischer S, Stark RG, Altenhofer J, Henze K, Parhofer KG. 2018. A walnut-enriched diet affects gut microbiome in healthy caucasian subjects: a randomized, controlled trial. Nutrients 10:244. doi: 10.3390/nu10020244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tang C, Kamiya T, Liu Y, Kadoki M, Kakuta S, Oshima K, Hattori M, Takeshita K, Kanai T, Saijo S, Ohno N, Iwakura Y. 2015. Inhibition of dectin-1 signaling ameliorates colitis by inducing Lactobacillus-mediated regulatory T cell expansion in the intestine. Cell Host Microbe 18:183–197. doi: 10.1016/j.chom.2015.07.003. [DOI] [PubMed] [Google Scholar]
  • 37.Agraib LM, Yamani MI, Rayyan YM, Abu-Sneineh AT, Tamimi TA, Tayyem RF. 2021. The probiotic supplementation role in improving the immune system among people with ulcerative colitis: a narrative review. Drug Metab Pers Ther. doi: 10.1515/dmdi-2021-0150. [DOI] [PubMed] [Google Scholar]
  • 38.Alard J, Peucelle V, Boutillier D, Breton J, Kuylle S, Pot B, Holowacz S, Grangette C. 2018. New probiotic strains for inflammatory bowel disease management identified by combining in vitro and in vivo approaches. Benef Microbes 9:317–331. doi: 10.3920/BM2017.0097. [DOI] [PubMed] [Google Scholar]
  • 39.Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux J-J, Blugeon S, Bridonneau C, Furet J-P, Corthier G, Grangette C, Vasquez N, Pochart P, Trugnan G, Thomas G, Blottière HM, Doré J, Marteau P, Seksik P, Langella P. 2008. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc Natl Acad Sci USA 105:16731–16736. doi: 10.1073/pnas.0804812105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zeeshan M, Atiq A, Ain QU, Ali J, Khan S, Ali H. 2021. Evaluating the mucoprotective effects of glycyrrhizic acid-loaded polymeric nanoparticles in a murine model of 5-fluorouracil-induced intestinal mucositis via suppression of inflammatory mediators and oxidative stress. Inflammopharmacol 29:1539–1553. doi: 10.1007/s10787-021-00866-z. [DOI] [PubMed] [Google Scholar]
  • 41.Peng F, Du Q, Peng C, Wang N, Tang H, Xie X, Shen J, Chen J. 2015. A review: the pharmacology of isoliquiritigenin. Phytother Res 29:969–977. doi: 10.1002/ptr.5348. [DOI] [PubMed] [Google Scholar]
  • 42.Liu D, Huo X, Gao L, Zhang J, Ni H, Cao L. 2018. NF-κB and Nrf2 pathways contribute to the protective effect of Licochalcone A on dextran sulphate sodium-induced ulcerative colitis in mice. Biomed Pharmacother 102:922–929. doi: 10.1016/j.biopha.2018.03.130. [DOI] [PubMed] [Google Scholar]
  • 43.Zhao L, Chen X, Shao X, Wang Z, Du Y, Zhu C, Du W, Tang D, Ji S. 2021. Prenylated phenolic compounds from licorice (Glycyrrhiza uralensis) and their anti-inflammatory activity against osteoarthritis. Food Funct 13:795–805. doi: 10.1039/D1FO03659A. [DOI] [PubMed] [Google Scholar]
  • 44.Shin HS, Satsu H, Bae M-J, Zhao Z, Ogiwara H, Totsuka M, Shimizu M. 2015. Anti-inflammatory effect of chlorogenic acid on the IL-8 production in Caco-2 cells and the dextran sulphate sodium-induced colitis symptoms in C57BL/6 mice. Food Chem 168:167–175. doi: 10.1016/j.foodchem.2014.06.100. [DOI] [PubMed] [Google Scholar]
  • 45.dos Santos MD, Almeida MC, Lopes NP, de Souza GEP. 2006. Evaluation of the anti-inflammatory, analgesic and antipyretic activities of the natural polyphenol chlorogenic acid. Biol Pharm Bull 29:2236–2240. doi: 10.1248/bpb.29.2236. [DOI] [PubMed] [Google Scholar]
  • 46.Sato Y, Itagaki S, Kurokawa T, Ogura J, Kobayashi M, Hirano T, Sugawara M, Iseki K. 2011. In vitro and in vivo antioxidant properties of chlorogenic acid and caffeic acid. Int J Pharm 403:136–138. doi: 10.1016/j.ijpharm.2010.09.035. [DOI] [PubMed] [Google Scholar]
  • 47.Lefèvre L, Authier H, Stein S, Majorel C, Couderc B, Dardenne C, Eddine MA, Meunier E, Bernad J, Valentin A, Pipy B, Schoonjans K, Coste A. 2015. LRH-1 mediates anti-inflammatory and antifungal phenotype of IL-13-activated macrophages through the PPARγ ligand synthesis. Nat Commun 6:6801. doi: 10.1038/ncomms7801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Coste A, Lagane C, Filipe C, Authier H, Galès A, Bernad J, Douin-Echinard V, Lepert J-C, Balard P, Linas M-D, Arnal J-F, Auwerx J, Pipy B. 2008. IL-13 attenuates gastrointestinal candidiasis in normal and immunodeficient RAG-2(-/-) mice via peroxisome proliferator-activated receptor-gamma activation. J Immunol 180:4939–4947. doi: 10.4049/jimmunol.180.7.4939. [DOI] [PubMed] [Google Scholar]
  • 49.Coste A, Dubourdeau M, Linas MD, Cassaing S, Lepert J-C, Balard P, Chalmeton S, Bernad J, Orfila C, Séguéla J-P, Pipy B. 2003. PPARgamma promotes mannose receptor gene expression in murine macrophages and contributes to the induction of this receptor by IL-13. Immunity 19:329–339. doi: 10.1016/S1074-7613(03)00229-2. [DOI] [PubMed] [Google Scholar]
  • 50.Benmoussa K, Authier H, Prat M, AlaEddine M, Lefèvre L, Rahabi MC, Bernad J, Aubouy A, Bonnafé E, Leprince J, Pipy B, Treilhou M, Coste A. 2017. P17, an original host defense peptide from ant venom, promotes antifungal activities of macrophages through the induction of C-type lectin receptors dependent on LTB4-mediated PPARγ activation. Front Immunol 8:1650. doi: 10.3389/fimmu.2017.01650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/KO000805. Accessed September 22, 2021.
  • 52.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PR100500. Accessed September 22, 2021.
  • 53.Li G, Nikolic D, van Breemen RB. 2016. Identification and chemical standardization of licorice raw materials and dietary supplements using UHPLC-MS/MS. J Agric Food Chem 64:8062–8070. doi: 10.1021/acs.jafc.6b02954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Celano R, Docimo T, Piccinelli AL, Rizzo S, Campone L, Di Sanzo R, Carabetta S, Rastrelli L, Russo M. 2021. Specialized metabolite profiling of different Glycyrrhiza glabra organs by untargeted UHPLC-HRMS. Industrial Crops and Products 170:113688–11368v.170. doi: 10.1016/j.indcrop.2021.113688. [DOI] [Google Scholar]
  • 55.Ye Z, Dai J-R, Zhang C-G, Lu Y, Wu L-L, Gong AGW, Xu H, Tsim KWK, Wang Z-T. 2017. Chemical differentiation of Dendrobium officinale and Dendrobium devonianum by using HPLC fingerprints, HPLC-ESI-MS, and HPTLC analyses. Evid Based Complement Alternat Med 2017:8647212. doi: 10.1155/2017/8647212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PM019101. Accessed September 22, 2021.
  • 57.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/BML01696. Accessed September 22, 2021.
  • 58.Xu T, Yang M, Li Y, Chen X, Wang Q, Deng W, Pang X, Yu K, Jiang B, Guan S, Guo D. 2013. An integrated exact mass spectrometric strategy for comprehensive and rapid characterization of phenolic compounds in licorice. Rapid Commun Mass Spectrom 27:2297–2309. doi: 10.1002/rcm.6696. [DOI] [PubMed] [Google Scholar]
  • 59.Fang S, Qu Q, Zheng Y, Zhong H, Shan C, Wang F, Li C, Peng G. 2016. Structural characterization and identification of flavonoid aglycones in three Glycyrrhiza species by liquid chromatography with photodiode array detection and quadrupole time-of-flight mass spectrometry. J Sep Sci 39:2068–2078. doi: 10.1002/jssc.201600073. [DOI] [PubMed] [Google Scholar]
  • 60.Tan G, Zhu Z, Zhang H, Zhao L, Liu Y, Dong X, Lou Z, Zhang G, Chai Y. 2010. Analysis of phenolic and triterpenoid compounds in licorice and rat plasma by high-performance liquid chromatography diode-array detection, time-of-flight mass spectrometry and quadrupole ion trap mass spectrometry. Rapid Commun Mass Spectrom 24:209–218. doi: 10.1002/rcm.4373. [DOI] [PubMed] [Google Scholar]
  • 61.Montero L, Ibáñez E, Russo M, di Sanzo R, Rastrelli L, Piccinelli AL, Celano R, Cifuentes A, Herrero M. 2016. Metabolite profiling of licorice (Glycyrrhiza glabra) from different locations using comprehensive two-dimensional liquid chromatography coupled to diode array and tandem mass spectrometry detection. Anal Chim Acta 913:145–159. doi: 10.1016/j.aca.2016.01.040. [DOI] [PubMed] [Google Scholar]
  • 62.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PR100559. Accessed September 22, 2021.
  • 63.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PM019112. Accessed September 22, 2021.
  • 64.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PM019111. Accessed September 22, 2021.
  • 65.Li Y-J, Chen J, Li Y, Li Q, Zheng Y-F, Fu Y, Li P. 2011. Screening and characterization of natural antioxidants in four Glycyrrhiza species by liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry. J Chromatogr A 1218:8181–8191. doi: 10.1016/j.chroma.2011.09.030. [DOI] [PubMed] [Google Scholar]
  • 66.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/PM019113. Accessed September 22, 2021.
  • 67.MassBank of North America. https://mona.fiehnlab.ucdavis.edu/spectra/display/BML00517. Accessed September 22, 2021.
  • 68.Authier H, Salon M, Rahabi M, Bertrand B, Blondeau C, Kuylle S, Holowacz S, Coste A. 2021. Oral administration of Lactobacillus helveticus LA401 and Lactobacillus gasseri LA806 combination attenuates oesophageal and gastrointestinal candidiasis and consequent gut inflammation in mice. JoF 7:57. doi: 10.3390/jof7010057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Khan Z, Mustafa AS, Alam FF. 2009. Real-time LightCycler polymerase chain reaction and melting temperature analysis for identification of clinically important Candida spp. J Microbiol Immunol Infect 42:290–295. [PubMed] [Google Scholar]
  • 70.Barman M, Unold D, Shifley K, Amir E, Hung K, Bos N, Salzman N. 2008. Enteric salmonellosis disrupts the microbial ecology of the murine gastrointestinal tract. Infect Immun 76:907–915. doi: 10.1128/IAI.01432-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Rehman A, Sina C, Gavrilova O, Häsler R, Ott S, Baines JF, Schreiber S, Rosenstiel P. 2011. Nod2 is essential for temporal development of intestinal microbial communities. Gut 60:1354–1362. doi: 10.1136/gut.2010.216259. [DOI] [PubMed] [Google Scholar]
  • 72.Bindels LB, Beck R, Schakman O, Martin JC, De Backer F, Sohet FM, Dewulf EM, Pachikian BD, Neyrinck AM, Thissen J-P, Verrax J, Calderon PB, Pot B, Grangette C, Cani PD, Scott KP, Delzenne NM. 2012. Restoring specific lactobacilli levels decreases inflammation and muscle atrophy markers in an acute leukemia mouse model. PLoS One 7:e37971. doi: 10.1371/journal.pone.0037971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Iliev ID, Funari VA, Taylor KD, Nguyen Q, Reyes CN, Strom SP, Brown J, Becker CA, Fleshner PR, Dubinsky M, Rotter JI, Wang HL, McGovern DPB, Brown GD, Underhill DM. 2012. Interactions between commensal fungi and the C-type lectin receptor Dectin-1 influence colitis. Science 336:1314–1317. doi: 10.1126/science.1221789. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES