Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae) |
Saccharomyces cerevisiae, various strains and genetic backgrounds |
See Supplementary file 1D | ||
| Strain, strain background (Escherichia coli) |
XL1 Blue | In-house | Electrocompetent cells | |
| Recombinant DNA reagent | T7-18S | This paper | HindIII digested, run-off in vitro transcription (see Materials and methods) |
|
| Recombinant DNA reagent | T7-25S | This paper | HindIII digested, run-off in vitro transcription (see Materials and methods) |
|
| Sequence-based reagent | sequencing adapter | Integrated DNA Technologies | Sequencing adapter – Supplementary file 1E |
/PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC |
| Sequence-based reagent | s.c. 18 S splint | Integrated DNA Technologies | Sequencing adapter splint – Supplementary file 1E |
CCTAAGAGCAAGAAGAAGCCTAATGATCCTTCC |
| Sequence-based reagent | s.c. 25 S splint | Integrated DNA Technologies | Sequencing adapter splint – Supplementary file 1E |
CCTAAGAGCAAGAAGAAGCCACAAATCAGACAA |
| Sequence-based reagent | s.c. IVT 18 S splint | Integrated DNA Technologies | Sequencing adapter splint – Supplementary file 1E |
CCTAAGAGCAAGAAGAAGCCAGCTTTAATGATC |
| Sequence-based reagent | s.c. IVT 25 S splint | Integrated DNA Technologies | Sequencing adapter splint – Supplementary file 1E |
CCTAAGAGCAAGAAGAAGCCAGCTTACAAATCA |
| Commercial assay or kit | Gibson Assembly Master Mix | New England Biolabs | E2611L | |
| Commercial assay or kit | MEGAscript T7 transcription kit | Invitrogen | AM1334 | |
| Commercial assay or kit | MinION Mk1B Sequencing Device | Oxford Nanopore Technologies | MIN-101B | |
| Commercial assay or kit | Flongle Adapter | Oxford Nanopore Technologies | ADP-FLG001 | |
| Commercial assay or kit | Direct RNA Sequencing Kit | Oxford Nanopore Technologies | SQK-RNA002 | |
| Commercial assay or kit | Flow Cell (R9.4.1) | Oxford Nanopore Technologies | FLO-MIN106D | |
| Commercial assay or kit | Flongle Flow Cell (R9.4.1) | Oxford Nanopore Technologies | FLO-FLG001 | |
| Commercial assay or kit | Flow Cell Priming Kit | Oxford Nanopore Technologies | EXP-FLP002 | |
| Commercial assay or kit | Flongle Sequencing Expansion | Oxford Nanopore Technologies | EXP-FSE001 | |
| Chemical compound, drug | Rapamycin | Research Products International | R64500-0.001 | |
| Chemical compound, drug | Potassium acetate | EMD Millipore | PX1330-1 | |
| Chemical compound, drug | Cycloheximide | Sigma | C7698-1G |