Skip to main content
. 2022 Apr 6;11:e76562. doi: 10.7554/eLife.76562

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background
(Saccharomyces cerevisiae)
Saccharomyces cerevisiae,
various strains and genetic backgrounds
See Supplementary file 1D
Strain, strain background
(Escherichia coli)
XL1 Blue In-house Electrocompetent cells
Recombinant DNA reagent T7-18S This paper HindIII digested, run-off in vitro
transcription (see Materials and methods)
Recombinant DNA reagent T7-25S This paper HindIII digested, run-off in vitro
transcription (see Materials and methods)
Sequence-based reagent sequencing adapter Integrated DNA Technologies Sequencing adapter –
Supplementary file 1E
/PHOS/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC
Sequence-based reagent s.c. 18 S splint Integrated DNA Technologies Sequencing adapter splint –
Supplementary file 1E
CCTAAGAGCAAGAAGAAGCCTAATGATCCTTCC
Sequence-based reagent s.c. 25 S splint Integrated DNA Technologies Sequencing adapter splint –
Supplementary file 1E
CCTAAGAGCAAGAAGAAGCCACAAATCAGACAA
Sequence-based reagent s.c. IVT 18 S splint Integrated DNA Technologies Sequencing adapter splint –
Supplementary file 1E
CCTAAGAGCAAGAAGAAGCCAGCTTTAATGATC
Sequence-based reagent s.c. IVT 25 S splint Integrated DNA Technologies Sequencing adapter splint –
Supplementary file 1E
CCTAAGAGCAAGAAGAAGCCAGCTTACAAATCA
Commercial assay or kit Gibson Assembly Master Mix New England Biolabs E2611L
Commercial assay or kit MEGAscript T7 transcription kit Invitrogen AM1334
Commercial assay or kit MinION Mk1B Sequencing Device Oxford Nanopore Technologies MIN-101B
Commercial assay or kit Flongle Adapter Oxford Nanopore Technologies ADP-FLG001
Commercial assay or kit Direct RNA Sequencing Kit Oxford Nanopore Technologies SQK-RNA002
Commercial assay or kit Flow Cell (R9.4.1) Oxford Nanopore Technologies FLO-MIN106D
Commercial assay or kit Flongle Flow Cell (R9.4.1) Oxford Nanopore Technologies FLO-FLG001
Commercial assay or kit Flow Cell Priming Kit Oxford Nanopore Technologies EXP-FLP002
Commercial assay or kit Flongle Sequencing Expansion Oxford Nanopore Technologies EXP-FSE001
Chemical compound, drug Rapamycin Research Products International R64500-0.001
Chemical compound, drug Potassium acetate EMD Millipore PX1330-1
Chemical compound, drug Cycloheximide Sigma C7698-1G