Table 2.
Nucleotide variations between assembled ∆gapN strain and reference strain from Genbank (CP004121.1).
| Position | Gene | Product | Type | Strand | Reference | ∆gapN |
|---|---|---|---|---|---|---|
| 41500 | – | – | del | GTTTTTG | GTTTTG | |
| 297173 | mdtN_1 | Multidrug resistance protein MdtN | ins | + | GAAGTAAA | GAAGTAAAAGTAAA |
| 807822 | – | – | snp | G | T | |
| 2136980 | ybdL | Methionine aminotransferase | del | + | TAG | TG |
| 2136989 | ybdL | Methionine aminotransferase | complex | + | AAAGA | AG |
| 2137002 | ybdL | Methionine aminotransferase | del | + | ATTTTTTG | ATTTTTG |
| 2169690 | 01968 | hypothetical protein | snp | – | G | A |
| 2170090 | 01968 | hypothetical protein | snp | – | T | C |
| 2170579 | 01968 | hypothetical protein | snp | – | C | T |
| 2170673 | 01968 | hypothetical protein | del | – | CGCCTTGACGACCTTGAGAG | CG |
| 2171011 | 01968 | hypothetical protein | snp | – | C | T |
| 3257186 | rocR_1 | Arginine utilisation regulatory protein RocR | snp | + | T | G |
| 3506222 | 03225 | Nucleotidase | snp | – | T | C |
| 3651781 | rsgI_2 | Antisigma‐I factor RsgI | ins | – | GG | GATGGAGTTG |
| 4705891 | – | – | snp | G | A | |
| 6036488 | fdtB_2 | dTDP‐3‐amino‐3,6‐dideoxy‐alpha‐d‐galactopyranose transaminase | snp | C | T | |
| 6036553 | fdtB_2 | dTDP‐3‐amino‐3,6‐dideoxy‐alpha‐d‐galactopyranose transaminase | snp | G | A |
del, deletion; ins; insertion; snp; single nucleotide polymorphism.
Comparison was performed using Snippy. The ∆gapN deletion is not shown.