Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for the taxonomic community analysis in this study.
| Domain target | Direction | Sequence | Length (bp) | Melting temperature | GC% |
| Bacteria | Fwd primer | AGAGTTTGATCCTGGCTCAG | 20 | 56.92 | 50.00 |
| Rv primer | ATTACCGCGGCTGCTGG | 17 | 60.18 | 64.71 |
