Reagents or Tools | Source | Identifier |
---|---|---|
Antibodies | ||
Rabbit Polyclonal Anti‐ACAT1 (WB) | Sigma | Cat# AV54278, RRID: AB_1844483 |
Mouse Monoclonal Anti‐ALCAM/CD166 (WB) | Santa Cruz Biotechnolgy | Cat# sc‐74558, RRID : AB_2289495 |
Mouse Monoclonal Anti‐ALCAM/CD166 (FACS) | BD Biosciences | Cat# 559260, RRID:AB_397209 |
Mouse Monoclonal Anti‐β‐Actin | Sigma‐Aldrich | Cat# A5316, RRID:AB_476743 |
Rabbit Polyclonal Anti‐BCAT1 | Aviva Systems Biology | Cat# ARP46132_P050, RRID:AB_10640125 |
Rabbit Polyclonal Anti‐BDH1 | Novus Biologicals | Cat# NBP1‐88673, RRID:AB_11009202 |
Rabbit Polyclonal Anti‐BDH2 | Sigma | Cat# HPA036028, RRID:AB_10670674 |
Rabbit Polyclonal Anti‐Hmgcl | Abcam | Cat# ab197022, RRID:AB_2797140 |
Rabbit Polyclonal Anti‐Hmgcll1 | Abcam | Cat# ab101576, RRID:AB_10712203 |
Rabbit monoclonal Anti‐HMGCS2 (IHC) | Abcam | Cat# ab137043, RRID: AB_2749817 |
Rabbit Polyclonal Anti‐HMGCS2 (WB) | Sigma | Cat# AV41562, RRID: AB_1850800 |
Rat Monoclonal Anti‐Ki67 | Biolegend | Cat# 652402, RRID:AB_11204254 |
Rabbit Polyclonal Anti‐SLC16A7/MCT2 | Bioss | Cat# bs‐3995R, RRID:AB_10855300 |
Rabbit Polyclonal Anti‐OXCT1 (SCOT1) | Novus Biologicals | Cat# NBP1‐82462, RRID:AB_11027140 |
Rabbit Polyclonal Anti‐OXCT2 (SCOT2) | Thermo Fisher Scientific | Cat# PA5‐49312, RRID:AB_2634766 |
Rat Polyclonal Human/Mouse anti‐Semaphorin 3C | R&D Systems | Cat# MAB1728, RRID:AB_2301533 |
Rabbit Polyclonal Anti‐SQLE | Proteintech | Cat# 12544‐1‐AP, RRID:AB_2195888 |
Rabbit Polyclonal Anti‐SLC5A8/SMCT1 | Bioss | Cat# bs‐6106R, RRID:AB_11108966 |
Goat Polyclonal Anti‐Rat IgG ‐ HRP | Santa Cruz Biotechnolgy | Cat# sc‐2006, RRID:AB_1125219 |
Goat Polyclonal Anti‐Mouse IgG Human ads ‐ HRP | Southern Biotechnolgy | Cat# 1030‐05, RRID:AB_2619742 |
Goat Polyclonal Anti‐Rabbit IgG – HRP | Southern Biotechnolgy | Cat# 4030‐05, RRID:AB_2687483 |
Rabbit Polyclonal Anti‐Goat IgG (H + L) – HRP | Southern Biotechnolgy | Cat# 6160‐05, RRID:AB_2796231 |
Goat Polyclonal Anti‐Mouse IgG (H + L) ‐ Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A‐11029, RRID:AB_138404 |
Biological Samples | ||
Healthy pancreas and PDA protein extract from PDA patients | Leca et al (2016) | https://doi.org/10.1172/JCI87734 |
Chemicals, Peptides, and Recombinant Proteins | ||
Lipofectamine 3000 | Thermo Fisher Scientific | Cat# L3000015 |
G418 | Thermo Fisher Scientific | Cat# 10131027 |
Mitomycin C | Sigma Aldrich | Cat# 10107409001 |
Collagenase type V | Sigma Aldrich | Cat# C9263 |
Critical Commercial Assays | ||
CellTrace™ CFSE Cell Proliferation Kit | Thermo Fisher Scientific | Cat# C34554 |
VECTASTAIN ABC kit | Vector | Cat# PK‐6100 |
Liquid DAB and substrate chromogen system | DAKO | Cat# K3468 |
Corning BioCoat™ Matrigel Invasion Chamber | Corning | Cat# 11553570 |
Trichrome Masson kit | RAL DIAGNOSTICS | Cat# 361350‐0000 |
Deposited Data | ||
9‐week RMA data | Guillaumond et al (2015) | GSE61412 |
6‐week RMA data | GSE127891 | |
Experimental Models: Cell Lines | ||
PK4a mouse cells | Guillaumond et al (2013) | RRID:CVCL_WB21 |
PANC‐1 human cells | ATCC | Cat# CRL‐1469, RRID:CVCL_0480 |
MiaPaCa‐2 human cells | ATCC |
Cat# CRL‐1420 RRID:CVCL_0428 |
Experimental Models: Organisms/Strains | ||
Pdx1‐Cre; Ink4a/Arffl/fl;LSL‐KrasG12Dmice | Aguirre et al (2003) | https://doi.org/10.1101/gad.1158703 |
HsdCpb:NMRI‐Foxn1nu | Envigo | Cat# 5652667, RRID:MGI:5652667 |
Oligonucleotides | ||
36B4 primer Forward AATCCCTGACGCACCGCCGTGATG | Guillaumond et al (2015) | https://doi.org/10.1073/pnas.1421601112 |
36B4 primer Reverse TGGGTTGTTTTCCAGGTGCCCTCG | Guillaumond et al (2015) | https://doi.org/10.1073/pnas.1421601112 |
Filamin B primer Forward AGTTAACCAGCCAGCATCCT | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Filamin B primer Reverse TGACATCGATGGTGTGGACA | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Epha2 primer Forward GGCTTCTTTATCCACCGCAG | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Epha2 primer Reverse CGAGGATGTCTTCAGCATGC | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Plau primer Forward TTCACCACCATCGAGAACCA | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Plau primer Reverse TTGCGTGTTGGAGTTAAGCC | Devis et al (2017) | https://doi.org/10.1002/path.4851 |
Recombinant DNA | ||
HMGCL Crispr/Cas9 KO plasmids | Santa Cruz Biotechnologies | Cat# sc‐422425 |
HMGCL HDR plasmids | Santa Cruz Biotechnologies | Cat# sc‐403841‐HDR |
Control CRISPR/Cas9Plasmid | Santa Cruz Biotechnologies | Cat# sc‐418922 |
pcDNA3.1(+)‐N‐DYK | GeneScript | / |
ALCAM cDNA (pcDNA3.1(+)‐N‐DYK) | GeneScript | / |
SQLE cDNA (pcDNA3.1(+)‐N‐DYK) | GeneScript | / |
Software and Algorithms | ||
R studio 3.4.4 | RStudio, Inc. | RRID:SCR_000432 |
Gene Set Enrichment Analysis with the fgsea package | Bioconductor | RRID:SCR_003199 |
Image J | National Institutes of Health | RRID:SCR_003070 |
Prism Version 5.03 | Graph Pad | RRID:SCR_002798 |
Ingenuity Pathway Analysis | IPA® | RRID:SCR_008653 |
FlowJo Version 10 | FlowJo LLC | RRID:SCR_008520 |
Other | ||
DMEM medium without glutamine (Gln‐) | Thermo Fisher Scientific | Cat# 11960‐044 |
DMEM medium without glutamine nor branched chain amino acid (BCAA‐) | Thermo Fisher Scientific | Cat# ME15212L1 |
DMEM medium without glutamine nor glucose (Glc‐) | Thermo Fisher Scientific | Cat# A14430‐01 |
Filtered foetal bovine serum | Hyclone | Cat# SH30070.02 |
Dialyzed foetal bovine serum | Hyclone | Cat# SH30079.02 |
Foetal bovine serum | BioSera | Cat# FB‐1280 |
Antibiotic/antimycotic solution | Thermo Fisher Scientific | Cat# 15240062 |
Leucine | Sigma Aldrich | Cat# L8912 |
Isoleucine | Sigma Aldrich | Cat# I7403 |
Valine | Sigma Aldrich | Cat# V0513 |
Sodium 3‐hydroxybutyrate | Sigma Aldrich | Cat# 54965 |
Acetoacetate | Sigma Aldrich | Cat# A8509 |
l‐Leucine (13C6) | Cambridge Isotope Laboratories | Cat# CLM‐2262‐H‐PK |
Sodium D‐3‐Hydroxybutyrate (13C4) | Cambridge Isotope Laboratories | Cat# CLM‐3853‐PK |
l‐glutamine (200 mM) | Thermo Fisher Scientific | Cat# 25030024 |
TransIT®‐LT1 | Mirus | Cat# MIR2300 |