| Strain, strain background (Escherichia coli) |
BL21(DE3) |
NEB |
C2527H |
|
| Genetic reagent (D. melanogaster) |
Lztr11
|
This paper |
|
CG3711/Lztr1 knockout |
| Genetic reagent (D. melanogaster) |
Lztr12
|
This paper |
|
CG3711/Lztr1 knockout |
| Genetic reagent (D. melanogaster) |
RasHA
|
This paper |
|
Transgene of HA-Ras at attP-86Fb landing site |
| Genetic reagent (D. melanogaster) |
RicHA
|
This paper |
|
Transgene of HA-Ric at attP-86Fb landing site |
| Genetic reagent (M. musculus) |
Lztr1-/-
|
EUCOMM |
Lztr1tm1a(EUCOMM)Wtsi; RRID: IMSR_EM:06794
|
Lztr1 knockout |
| Genetic reagent (M. musculus) |
Rit1-/-
|
This paper |
|
Rit1 knockout |
| Genetic reagent (M. musculus) |
Lztr1-/-;Rit1-/-
|
This paper |
|
Lztr1 and Rit1 double knockout |
| Genetic reagent (M. musculus) |
129S1/Svlmj |
Jackson Laboratories |
002448; RRID:IMSR_JAX:002448
|
|
| Recombinant DNA reagent |
pcDNA3-DEST-Flag-SOScat (H. sapiens) |
This paper |
|
Vector to express Flag-SOS1 (residues 564–1049) in mammalian cells. |
| Recombinant DNA reagent |
pcDNA3-DEST-HA-LZTR1 (H. sapiens) |
This paper |
|
Vector to express HA-LZTR1 in mammalian cells. |
| Recombinant DNA reagent |
pcDNA3-DEST-HA-LZTR1 (M. musculus) |
This paper |
|
Vector to express HA-LZTR1 in mammalian cells. |
| Recombinant DNA reagent |
pcDNA3-DEST-HA-LZTR1 (D. rerio) |
This paper |
|
Vector to express HA-LZTR1 in mammalian cells. |
| Recombinant DNA reagent |
pcDNA3-DEST-HA-LZTR1 (D. melanogaster) |
This paper |
|
Vector to express HA-LZTR1 in mammalian cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-KRAS (H. sapiens) |
This paper |
|
Vector to express GST-KRAS in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-RIT1 (H. sapiens) |
This paper |
|
Vector to express GST-RIT1 in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-KRAS (M. musculus) |
This paper |
|
Vector to express GST-KRAS in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-RIT1 (M. musculus) |
This paper |
|
Vector to express GST-RIT1 in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-KRAS (D. rerio) |
This paper |
|
Vector to express GST-KRAS in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-RIT1 (D. rerio) |
This paper |
|
Vector to express GST-RIT1 in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-RAS (D. melanogaster) |
This paper |
|
Vector to express GST-KRAS in E. coli cells. |
| Recombinant DNA reagent |
pGEX-6P-DEST-RIC (D. melanogaster) |
This paper |
|
Vector to express GST-RIT1 in E. coli cells. |
| Antibody |
Anti-HA (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 3724; RRID: AB_1549585
|
WB (1:3,000) |
| Antibody |
Anti-Flag (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 14793; RRID: AB_2572291
|
WB (1:3,000) |
| Antibody |
Anti-p-ERK1/2 (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 4370; RRID: AB_2315112
|
WB (1:1,000) |
| Antibody |
Anti-ERK1/2 (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 4696; RRID: AB_390780
|
WB (1:2,000) |
| Antibody |
Anti-p-MEK1/2 (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 9154; RRID: AB_2138017
|
WB (1:1,000) |
| Antibody |
Anti-MEK1/2 (Mouse monoclonal) |
Cell Signalling Technology |
Cat#: 4694; RRID: AB_10695868
|
WB (1:1,000) |
| Antibody |
Anti-RIT1 (Rabbit polyclonal) |
Abcam |
Cat#: ab53720; RRID: AB_882379
|
WB (1:1,000) |
| Antibody |
Anti-b-Actin (Mouse monoclonal) |
Sigma-Aldrich |
Cat#: A2228; RRID: AB_476697
|
WB (1:10,000) |
| Antibody |
Anti-a-Tubulin (Mouse monoclonal) |
Sigma-Aldrich |
Cat#: T6199; RRID: AB_477583
|
WB (1:10,000) |
| Antibody |
Anti-KRAS (Mouse monoclonal) |
Sigma-Aldrich |
Cat#: WH0003845M1; RRID: AB_1842235
|
WB (1:500) |
| Antibody |
Anti-Ras (Rabbit monoclonal) |
Cell Signalling Technology |
Cat#: 4370; RRID: AB_2910195
|
WB (1:1,000) |
| Antibody |
Anti-NRAS (Mouse monoclonal) |
Santa Cruz Biotechnology |
Cat#: sc-31; RRID: AB_628041
|
WB (1:1,000) |
| Antibody |
Anti-HRAS (Rabbit polyclonal) |
Santa Cruz Biotechnology |
Cat#: sc-520; RRID: AB_631670
|
WB (1:500) |
| Antibody |
Anti-LZTR1 (Mouse monoclonal) |
Santa Cruz Biotechnology |
Cat#: sc-390166X; RRID: AB_2910196
|
WB (1:1,000) |
| Sequence-based reagent |
Dusp6_F |
This paper |
PCR primers |
TCCTATCTCGGATCACTGGAG |
| Sequence-based reagent |
Dusp6_R |
This paper |
PCR primers |
GCTGATACCTGCCAAGCAAT |
| Sequence-based reagent |
Spry2_F |
This paper |
PCR primers |
CATCGCTGGAAGAAGAGGAT |
| Sequence-based reagent |
Spry2_R |
This paper |
PCR primers |
CATCAGGTCTTGGCAGTGT |
| Sequence-based reagent |
Tbp_F |
This paper |
PCR primers |
CCTTGTACCCTTCACCAATGAC |
| Sequence-based reagent |
Tbp_R |
This paper |
PCR primers |
ACAGCCAACATTCACGGTAGA |
