Key Resources Table
| REAGENT OR RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-VAPA | Novus biologicals | Cat no # H00009218 |
| Rabbit polyclonal anti-CERT | Abeam | Cat no # ab72536 |
| Mouse anti-Flotillin-1 | BD Biosciences | Cat no # 610820 |
| Mouse monoclonal anti-HSP70 | SCBT | Cat no # sc-66048 |
| Rabbit polyclonal anti-Tsg101 | Abcam | Cat no # ab30871 |
| Rabbit monoclonal anti-CD63 (for WB) | Abcam | Cat no # ab134045 |
| Mouse anti-CD63 (for IF) | Abcam | Cat no #ab8219 |
| Rabbit monoclonal anti-Ago2 | Cell Signaling | Cat no # 2897 |
| Mouse monoclonal anti-hnRNPA2B1 | Cell Signaling | Cat no # 9304 |
| Rabbit polyclonal anti-hnRNPQ | Abcam | Cat no # ab189405 |
| Mouse monoclonal anti-KDEL | Abcam | Cat no # ab |
| Mouse monoclonal anti-Beta actin | Cell Signaling | Cat no# 58169 |
| Rabbit monoclonal anti-Bip-1 | Cell Signaling | Cat no# 3177 |
| Rabbit monoclonal anti-IRE1a | Cell Signaling | Cat no # 3294 |
| Rabbit anti-Cleaved caspase 3 | Abcam | Cat no # ab32042 |
| Rabbit anti-nSMase 2 | Abcam | Cat no # ab85017 |
| Rabbit anti-hnRNPQ (SYNCRIP) | Abcam | Cat no# abl 84946 |
| Rabbit anti-KDEL | Abcam | Cat no # ab176333 |
| Rabbit anti-Syntenin | Abcam | Cat no # ab133267 |
| Rabbit anti-CERT | Abcam | Cat no # ab151285 |
| Mouse anti-Alix | Cell Signaling | Cat no # 2171A |
| Rabbit anti-LC3B | Cell signaling | Cat no # 3868 |
| Mouse anti-GM130 | BD Biosciences | Cat no # BD610822 |
| Rabbit monoclonal anti-GAPDH | Cell Signaling | Cat no #5174 |
| Anti-Mouse IgG (H+L), HRP Conjugate | Promega | Cat no # W4021 |
| Anti-Rabbit IgG (H+L), HRP Conjugate | Promega | Cat no # W4011 |
| Chemicals | ||
| Thapsigargin | Millipore-Sigma | Cat no # T9033 |
| Staurosporine | Cell Signaling | Cat no #9953 |
| Puromycin Dihydrochloride | Sigma Aldrich | Cat no # P8333 |
| Critical Commercial Assays | ||
| Micro BCA Protein Assay Kit | Thermo Fisher Scientific | Cat no # 23235 |
| BCA protein assay kit | Thermo Fisher Scientific | Cat no # 23225 |
| Micro Rneasy Mini Kit | Qiagen | Cat no # 217004 |
| Steady-Glo® Luciferase Assay System | Promega | Cat no # E2510 |
| β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer | Promega | Cat no # E2000 |
| TaqMan™ MicroRNA Reverse Transcription Kit | Thermo Fisher Scientific | Cat no # 4366597 |
| TaqMan™ Universal Master Mix II, no UNG | Thermo Fisher Scientific | Cat no # 4440049 |
| iScript™ cDNA Synthesis Kit | Bio Rad | Cat no # 1708890 |
| SsoAdvanced Universal SYBR Green Supermix | Bio Rad | Cat no # 1725270 |
| Qubit™ RNA HS Assay Kit | Thermo Fisher Scientific | Cat No #Q32852 |
| Duolink™ In Situ Orange Starter Kit Mouse/Rabbit | Millipore Sigma | Cat no #DUO92102-1KT |
| Experimental Models: Organism/Strain | ||
| BLAB/c female mice | Charles River Laboratory | |
| Oligonucleotides | ||
| snoRA42 Forward 5’TGGATTTATGGTGGGTCCTTCTCTG3’ | MilliporeSigma/Genosys | |
| snoRA42 Reverse 5’CAGGTAAGGGGACTGGGCAATGGTT3’ | MilliporeSigma/Genosys | |
| snoRD45 Forward 5’CATCTATAATGGCTGAATTGGAA3’ | MilliporeSigma/Genosys | |
| snoRD45 Reverse 5’ATGAACTTTCCAACAAATGTTGTT3’ | MilliporeSigma/Genosys | |
| snoRA40 Forward 5’ ATGTATGTTTTTGTTTAACG 3’ | MilliporeSigma/Genosys | |
| snoRA40 Reverse 5’ CAAAACTCATACTGAACAATG 3’ | MilliporeSigma/Genosys | |
| snoRD105 forward 5’ ATCTCTCATGATGAACACATATG3’ | MilliporeSigma/Genosys | |
| snoRD105 Reverse 5’ CCATCTCTTCTTCAGAGCG 3’ | MilliporeSigma/Genosys | |
| TaqMan™ MicroRNA Assay | Thermo Fisher Scientific | Cat no # 4427975 |
| U6 snRNA | Thermo Fisher Scientific | Cat no # 001973 |
| hsa-miR-371a | Thermo Fisher Scientific | Cat no # 002124 |
| hsa-miR-372 | Thermo Fisher Scientific | Cat no # 000560 |
| hsa-let-7a | Thermo Fisher Scientific | Cat no # 000377 |
| hsa-miR-100 | Thermo Fisher Scientific | Cat no # 000437 |
| hsa-miR-125b | Thermo Fisher Scientific | Cat no # 000449 |
| hsa-miR-320a | Thermo Fisher Scientific | Cat no # 002277 |
| hsa-miR-30a | Thermo Fisher Scientific | Cat no #000417 |
| hsa-miR-129 | Thermo Fisher Scientific | Cat no #000590 |
| hsa-miR-99a | Thermo Fisher Scientific | Cat no #000435 |
| TRC Lentiviral shRNA -VAP-A | Dharmacon | Cat no #RHS3979-201759439 Cat no #RHS3979-201759438 |
| TRC Fentiviral shRNA -CERT | Dharmacon | Cat no #RHS3979-201738486 Cat no #RHS3979-201738485 |
| pLKO.1 scrambled control construct | Addgene | Plasmid no #26701 |
| Pre-miR-let-7a | Thermo Scientific | Cat no #AM17100 (ID PM10050) |
| Pre-miR-100 | Thermo Scientific | Cat no #AM17100 (ID PM10188) |
| Anti-miR-100 | Thermo Scientific | Cat no #AM17000 (ID AM10188) |
| Anti-miR control | Thermo Scientific | Cat no #AM17010 |
| RNase A | Thermo Scientific | Cat no #EN0531 |
| Recombinant DNA | ||
| EGFP-Rab5A Q79F | Addgene | Cat no # 28046 |
| mCherry-Rab5CA(Q79L) | Addgene | Cat no # 35138 |
| pEGFPC1-hVAP-A | Addgene | Cat no #104447 |
| Tissue culture reagents | ||
| DMEM | Corning | Cat no #10-013-CV |
| Fetal bovine serum | Sigma | Cat no #F0926 |
| Bovine growth serum | Hyclone | Cat no #SH30073.03 |
| Lipofectamine 2000 | Thermo Scientific | Cat no #11668-019 |
| TransITX2 | Mirus Bio | Cat no #MIR 6004 |
| MFP-488 | Mirus Bio | Cat no #MIR7125 |
| Cy3 | Mirus Bio | Cat no #MIR3625 |
| Software and algorithms | ||
| GraphPad Prism 9.2.1 | https://www.graphpad.com/scientific-software/prism/ | |
| ImageJ / Fiji | NIH | |
| NIS Elements | Nikon Instruments, Inc | |
| Dragonfly ORS | http://www.theobjects.com/dragonfly | |
| IMOD | ||
| cutadapt v1.18 | (https://github.com/marcelm/cutadapt) | |
| ncPRO-seq (version 1.5.1) | ||
| DESeq2 | ||
| Msp20210527163602_converted.lbm2 | ||
| pheatmap version 1.0.12 | pheatmap: Pretty Heatmaps version 1.0.12 from CRAN (rdrr.io) | |
| Xcalibur v.2.1.0 software | Thermo | |
| LCQuan v.2.7.0 software | Thermo | |
| Limma version 3.48.1 | https://bioconductor.org/packages/release/bioc/html/limma.html | |
| MS-DIAL ver4 | http://prime.psc.riken.jp/ | |
| Adobe Photoshop 2020 | Adobe | |