Key Resource Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Bacterial and virus strains | ||
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| DNase I (RNase-free) | New England Biolabs | M0303L |
| RNase R | MCLAB | RNASR-100 |
| Millennium™ RNA Markers | ThermoFisher | AM7150 |
| Bullseye Agarose | MidSci | BE-A500 |
| SYBR™ Safe DNA Gel Stain | ThermoFisher | S33102 |
| SYBR™ GOLD Nucleic Acid Gel Stain | ThermoFisher | S11494 |
| BrightStar™-Plus Positively Charged Nylon Membrane | ThermoFisher | AM10100 |
| RNA Gel Loading Dye (2X) | ThermoFisher | R0641 |
| Gel Loading Buffer II | ThermoFisher | AM8546G |
| Ultrapure™ Formamide | ThermoFisher | 15515026 |
| EDTA (0.5M), pH 8.0, RNase-Free | ThermoFisher | AM9260G |
| Ultrapure™ SDS Solution, 10% | ThermoFisher | 15553027 |
| SuperBlock™ (PBS) Blocking Buffer | ThermoFisher | 37515 |
| RiboLock RNase Inhibitor | ThermoFisher | EO0381 |
| IRDye® 800CW Streptavidin | LI-COR | 926-32230 |
| RNA ScreenTape | Agilent | 5067-5576 |
| RNA ScreenTape Sample Buffer | Agilent | 5067-5577 |
| RNA ScreenTape Ladder | Agilent | 5067-5578 |
| RNase H | New England Biolabs | M0297S |
| T4 RNA Ligase I | New England Biolabs | M0204S |
| Critical commercial assays | ||
| Platinum™ SuperFi II PCR Master Mix | ThermoFisher | 12368010 |
| NEBuilder® HiFi DNA Assembly Master Mix | New England Biolabs | E2621S |
| HiScribe T7 High Yield RNA Synthesis Kit | New England Biolabs | E2040S |
| Q5 Hot Start High-Fidelity 2x Master Mix | New England Biolabs | M0494X |
| DNA Clean & Concentrator-100 | Zymo Research | D4029 |
| Monarch® RNA Cleanup Kit | New England Biolabs | T2050L |
| NorthernMax™-Gly Kit | ThermoFisher | AM1946 |
| Pierce™ RNA 3’ End Biotinylation Kit | ThermoFisher | 20160 |
| iBlot™ 2 Transfer Stacks, nitrocellulose, mini | ThermoFisher | IB23002 |
| E-Gel™ EX Agarose Gels, 2% | ThermoFisher | G401002 |
| E-Gel™ Agarose Gels with SYBR™ Safe, 2% | ThermoFisher | G521802 |
| Deposited data | ||
| Original Image Files | This paper | DOI: 10.17632/62bwm34jvr.1 |
| Experimental models: cell lines | ||
| Experimental models: organisms/strains | ||
| Oligonucleotides | ||
| Circular precursor F: taatacgactcactatagggagaccc | This paper | N/A |
| Circular precursor R: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTcaggaaacagctatgaccatgattacg | This paper | N/A |
| Linear control F – GLUC: CATGCATGCATGCATGGCCAGTGAATTGTAATACGACTCACTATAGGGaaaatccgttgaccttaaacgg | This paper | N/A |
| Linear control R – GLUC: aagtccgtagcgtctcg | This paper | N/A |
| 1-UpExc: ctcccgtcgagtctctgcaccttccgattagttgtaagtcatctattgtt |
This paper | BTA-NB011 |
| 2-UpRet: tgggggtggagggacttgaacccacacgaccgtttaaggtcaacggattt | This paper | BTA-NB013 |
| 3-GLUC: tcgagatccgtggtcgcgaagttgctggccacggccacgatgttgaagtc | This paper | BTA-NB019 |
| 4-DownRet: aagtccgtagcgtctcgccggtaacgcataatagccgttttgttttttgt | This paper | BTA-NB017 |
| 5-DownExc: cttactaattactacttcggcttggctcaggattgccttgtctataacta | This paper | BTA-NB012 |
| 6-ANA Splice Junction: cacgaccgtttaaggtcaacggattttaagtccgtagcgtctcgc | This paper | BTA-NB020 |
| RNase H Probe | Wesselhoeft et al., 2019 | |
| Recombinant DNA | ||
| GLuc APIE CVB3 pAC | Wesselhoeft et al., 2019 | N/A |
| circFOREIGN | Chen et al., 2019 | N/A |
| pNL1.1.PGK[Nluc/PGK] | Promega | N1441 |
| Software and algorithms | ||
| Bio-Rad Image Lab v5.2 | Bio-Rad | https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z |
| Li-COR Image Studio Acquisition Software v3.1 | Li-COR | https://www.licor.com/bio/image-studio/ |
| Li-COR Image Studio Lite Software v5.2 | Li-COR | https://www.licor.com/bio/image-studio-lite/ |
| Other | ||