KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| CD8a-BV650 | BioLegend | 100742; RRID:AB_2563056 |
| CD11b-BV650 | BioLegend | 101259; RRID:AB_2566568 |
| Gr1-BV650 | BioLegend | 108442; RRID:AB_2686974 |
| TER119-BV650 | BioLegend | 116235; RRID:AB_11204244 |
| B220-BV650 | BioLegend | 103241; RRID:AB_11204069 |
| CD4-BV650 | BioLegend | 563232; RRID:AB_2738083 |
| CD8a-PE/Cy7 | BioLegend | 100722; RRID:AB_312761 |
| CD11b-PE/Cy7 | BioLegend | 101216; RRID:AB_312799 |
| Gr1-PE/Cy7 | BioLegend | 108416; RRID:AB_313381 |
| TER119-PE/Cy7 | BioLegend | 116221; RRID:AB_2137789 |
| B220-PE/Cy7 | BioLegend | 103222; RRID:AB_313005 |
| CD4-PE/Cy7 | BioLegend | 100422; RRID:AB_2660860 |
| cKit-BV711 | BioLegend | 105835; RRID:AB_2565956 |
| cKit-BV421 | BioLegend | 105828; RRID:AB_11204256 |
| cKit-PE | BioLegend | 105808; RRID:AB_313217 |
| Sca1-APC/Cy7 | BioLegend | 108126; RRID:AB_10645327 |
| CD150-PE/Cy5 | BioLegend | 115912; RRID:AB_493598 |
| CD48-Pacific Blue | BioLegend | 103418; RRID:AB_756140 |
| Ki67-PE | Invitrogen | 12-5698-80; RRID:AB_11149672 |
| Gr1-APC | BioLegend | 108412; RRID:AB_313377 |
| CD11b-APC/Cy7 | BioLegend | 101226; RRID:AB_830642 |
| CD150-BV605 | BioLegend | 115927; RRID:AB_11204248 |
| CD48-BV421 | BioLegend | 103428; RRID:AB_2650894 |
| CD34-FITC | BD Biosciences | 553733; RRID:AB_395017 |
| CD34-AF700 | BD Biosciences | 560518; RRID:AB_1727471 |
| CD45.1-FITC | BioLegend | 110706; RRID:AB_313495 |
| CD45.2-Pacific Blue | BioLegend | 109820; RRID:AB_492872 |
| CD45.1-PE/Cy7 | BioLegend | 110730; RRID:AB_1134168 |
| CD127-PE | BioLegend | 121112; RRID:AB_493509 |
| CD16/32-APC | BioLegend | 101326; RRID:AB_1953273 |
| CD8a-FITC | BioLegend | 100706; RRID:AB_312745 |
| CD11b-FITC | BioLegend | 101206; RRID:AB_312789 |
| Gr1-FITC | BioLegend | 108406; RRID:AB_313371 |
| Ter119-FITC | BioLegend | 116206; RRID:AB_313707 |
| B220-FITC | BioLegend | 103206; RRID:AB_312991 |
| CD4-FITC | BioLegend | 100406; RRID:AB_312691 |
| CD48-PE/Cy7 | BioLegend | 103424; RRID:AB_2075049 |
| B220-AF700 | BioLegend | 103232; RRID:AB_493717 |
| Active Caspase3-PE | BD Biosciences | 561011; RRID:AB_2033931 |
| CD4-PE/Cy5 | BioLegend | 100410; RRID:AB_312695 |
| CD8a-PE/Cy5 | BioLegend | 100710; RRID:AB_312749 |
| H3K4me3 | Millipore | 07-473; RRID:AB_1977252 |
| H3K27me3 | Cell Signaling | C36B11; RRID:AB_11220433 |
| Chemicals, peptides, and recombinant proteins | ||
| BD Cytofix/Cytoperm Kit | BD | 554722 |
| Dynabeads Untouched Mouse CD4 Kit | Life Technologies | 11415D |
| FastSYBR Green Master Mix | Thermo Fisher Scientific | 4385610 |
| OneComp eBeads | eBioscience | 01-1111-41 |
| AMPure/RNAClean XP beads | Beckman Coulter | A63881 |
| Deoxynucleotide Solution, Mix | NEB | N0447S |
| ProtoScript II Reverse Transcriptase | NEB | M0368L |
| Murine Rnase Inhibitor | NEB | M0314L |
| Rnase H, recombinant | NEB | M0297L |
| DNA Polymerase I | NEB | M0209L |
| DAPI | Sigma-Aldrich | D9542 |
| All-trans-retinoic acid (at-RA) | Sigma-Aldrich | R2625 |
| 13-cis-4oxo-Retinoic acid (in vivo) | Sigma-Aldrich | 42073 |
| 4-Oxo-(9-cis,13-cis)-Retinoic acid (in vitro) | Santa Cruz Biotechnology | sc-477908 |
| Retinol | Sigma-Aldrich | R7632 |
| Rotenone | Sigma-Aldrich | R8875 |
| Antimycin A | Sigma-Aldrich | A8674 |
| Oligomycin | Sigma-Aldrich | O4876 |
| FCCP | Sigma-Aldrich | C2920 |
| Recombinant Human Flt3 | PeproTech | 300-19 |
| Recombinant Murine Stem Cell Factor | PeproTech | 250-03 |
| Recombinant Murine Thrombopoietin | PeproTech | 315-14 |
| ACK Lysing Buffer | Lonza | 10-548E |
| Poly-D-Lysine | Sigma-Aldrich | P6407 |
| StemPro-34 SFM (1X) | Life Technologies | 10639011 |
| Methocult Mouse M3434 | Stem Cell Technologies | M3434 |
| XF DMEM medium | Agilent | 103575-100 |
| XF 1.0 M Glucose Solution | Agilent | 103577-100 |
| XF 100 mM Pyruvate Solution | Agilent | 103578-100 |
| XF 200 mM Glutamine Solution | Agilent | 103579-100 |
| MitoTracker Green | Thermo Fisher Scientific | M7514 |
| Protein G Dynabeads | Invitrogen | 10003D |
| Q5® High-Fidelity 2X Master Mix | NEB | M0492S |
| NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs) | NEB | E6440 |
| Formaldehyde 16% | Pierce | 28906 |
| IDT unique dual indexing primers | Illumina | 20027213 |
| Digitonin | Promega | G9441 |
| BSA solution | Sigma-Aldrich | A8577 |
| Critical commercial assays | ||
| SuperScript VILO cDNA Synthesis Kit | Invitrogen | 11754050 |
| QIAGEN Plasmid Maxi Kit | QIAGEN | 12163 |
| PicoPure® RNA Isolation Kit | Thermo Fisher Scientific | KIT0204 |
| Click-iT® Plus OPP Protein Synthesis Assay Kit *Alexa Fluor® 594 picolyl azide | Life Technologies | C10457 |
| MEGAscript T7 Transcription Kit | Thermo FFisher Scientific | AM1334 |
| QIAGEN MinElute PCR clean up kit | QIAGEN | 28204 |
| Tagment DNA TDE1 Enzyme and Buffer Kits | Illumina | 20034197 |
| NEBNext Ultra II FS DNA library kit | NEB | E7805 |
| SMARTseq v4 | Takare Bio | 634889 |
| NEBNext Secondary Strand Synthesis Reaction Buffer | NEB | B6117S |
| Nextera XT DNA Sample Preparation Kits | Illumina | 1502354 |
| Deposited data | ||
| RNA Seq of control and Vitamin A-deficient HSCs and MPPs | This paper | ArrayExpress: E-MTAB-9729 |
| RNA Seq of control and Cyp26b1KO HSCs | This paper | ArrayExpress: E-MTAB-9745 |
| RNA Seq of 7-month-old control and Cyp26b1KO HSCs | This paper | ArrayExpress: E-MTAB-10659 |
| RNA Seq of control and Cyp26b1KO HSCs+MPP1 after 24h of in vitro culture and treatment | This paper | ArrayExpress: E-MTAB-9752 |
| RNA Seq of wildtype and Rarb KO HSCs after 24h of in vitro culture and treatment | This paper | ArrayExpress: E-MTAB-9749 |
| ATAC-seq of HSCs and MPPs | This paper | ArrayExpress: E-MTAB-9779 |
| ATAC-seq of HSCs in Vitamin A-free diet | This paper | ArrayExpress: E-MTAB-9780 |
| ATAC-seq of control and Cyp26b1KO HSCs | This paper | ArrayExpress: E-MTAB-9778 |
| ChIP-seq for H3K4me3 and H3K27me3 in HSCs and MPPs | This paper | ArrayExpress: E-MTAB-10661 |
| Experimental models: Organisms/strains | ||
| C57BL/6J (CD45.2) | MPI-IE | RRID:IMSR_JAX:002014 |
| B6Ly5.1 (CD45.1) | MPI-IE | RRID:IMSR_JAX:000664 |
| B6Ly5.1(CD45.1/2) | MPI-IE | N/A |
| Mx1Cre (B6. Cg-Tg(Mx1-cre)1Cgn/J) | Kühn et al., 1995 | RRID:IMSR_JAX:003556 |
| SclCre (B6. Tg(Tal1-cre)42-056Jrg) | Göthert et al., 2005 | MGI: 3579158 |
| Cyp26b1 fl/fl (B6-Cyp26b1tm2Hmd) | MacLean et al., 2007 | RRID:IMSR_RBRC04333 |
| RarbKO (Stock Rarbtm1Vg1/HsvJ) | The Jackson Laboratory | RRID:IMSR_JAX:022999 |
| MitoOrp (B6-Gt(ROSA)26Sor(mito-Orp-roGFP2) Tg(CMV-cre)1Cgn) | Fujikawa et al., 2016 | N/A |
| RargKO | Chapellier et al., 2002; Provided by N.B. Ghyselinck | N/A |
| Oligonucleotides | ||
| shRNA Rarb TGCTGTTGACAGTGAGCGCCCGCAGA AGATGTATTCTTCTGAATACTTCTGCG GATGCCTA CTGCCTCGGA | Sigma-Aldrich | N/A |
| shRNA Renilla AAGGTATATTGCTGTTGACAGTGAGC GCAGGAATTATAATGCTTATCTATAGTGAAGCCACA GATGTATAGATAAGCATTATAATTCCTATGCCTACTG CCTCGGACTTCAAGGGGCTA | Sigma-Aldrich | N/A |
| Software and algorithms | ||
| FACSDiva | BD | RRID:SCR_001456 |
| FlowJo10 | FlowJo LLC | RRID:SCR_008520 |
| Prism8 | Graphpad Software | RRID:SCR_002798 |
| Integrative Genomics Viewer (IGV) | N/A | RRID:SCR_011793 |
| DAVID v6.8 | Huang et al., 2009 | https://david.ncifcrf.gov |
| snakePipes (2.5.1) | Bhardwaj et al., 2019 | https://github.com/maxplanck-ie/snakepipes |
| deepTools (3.4.0) | Ramírez et al., 2014 | https://github.com/deeptools/deepTools/ |
| STAR v2.7.4a | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| Bowtie2 (2.4.4) | Langmead and Salzberg, 2012 | https://github.com/BenLangmead/bowtie2 |
| MACS2 (2.2.7.1) | Zhang et al., 2008 | https://github.com/macs3-project/MACS |
| bedtools (2.30.0) | Quinlan and Hall, 2010 | https://github.com/arq5x/bedtools2 |
| pyDNase (0.3.0) | Piper et al., 2013 | https://github.com/jpiper/pyDNase |
| Subread (2.0.3) | Liao et al., 2014 | https://sourceforge.net/projects/subread/ |
| GSEA_4.1.0 | Subramanian et al., 2005 | https://www.gsea-msigdb.org/gsea/index.jsp |