Table 2.
Primers used in this study.
| Oligo | Nucleotide positions | Sequence 5’→3’ | Use |
|---|---|---|---|
| L2788Fwd | 2788-2804 | (P)AGTCTGAGAGAGATCTA | Nucleotide change |
| L2788Rev | 2768-2787 | (P)TCCATGCTGTTGTTTCTTAA | |
| L3166Fwd | 3166-3187 | (P)GTTAGAGATGACTTTGTGATGG | |
| L3166Rev | 3149-3165 | (P)ATCAAGCTCCCGATGAC | |
| L3925Fwd | 3915-3935 | TCTCTTCAAAACTATCACCAG | |
| L3925Rev | 3897-3914 | TTAAATCTGAAACCTCCC | |
| RdRp Fwd | 2701-2723 | GCTATCCAGAAGTTTGAGGATTG | PCR and sequencing of RdRp core |
| RdRp Rev2 | 4055-4077 | TAGAGAGGAGCTAAGAATTAGAG |
Nucleotide changed to introduce the corresponding mutation is bold-typed. The correspondence between nucleotide changed at the indicated position within the segment L and amino acid substitution in the L-protein is as follows: change G2788A leads to Gly924Ser, change A3166G leads to Ile1050Val, and change G3925A leads to Ala1303Thr.
Sequences are based on the sequence DQ375403.1 corresponding to Rift Valley fever virus strain ZH-548 segment L.