Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for genotyping TNF‐α −308G>A PCR products digested by NcoI restriction enzyme
| Primers | Sequences 5′–3′ |
Undigested (bp) |
Homozygous Wildtype (bp) GG |
Homozygous mutant (bp) AA |
Heterozygous (bp) GA |
|---|---|---|---|---|---|
| TNF‐F | GGAGGCAATAGGTTTTGAGGGCCAT | ||||
| TNF‐R | CTGTCT‐CGGTTTCTTCTCCATGGCG | 195 | 173 | 195 | 173 and 195 |
Sizes of the PCR products (bp) are shown.
Abbreviations: bp, base pair; TNF‐F, forward primer; TNF‐R, reverse primer.
