KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Human CD3-BUV395 (Clone SK7) | BD Biosciences | Cat# 564000; RRID: AB_2744382 |
| Human CD45-PE (Clone HI30) | BioLegend | Cat# 304008; RRID:AB_314396 |
| Human Tim3/CD366-BV711 (clone 7D3) | BD Biosciences | Cat# 565566, RRID: AB_2744370 |
| Human Lag3/CD223-AF647 (Clone T47–530) | BD Biosciences | Cat# 565716; RRID: AB_2744328 |
| Human PD1/CD279-BV786 (Clone EH12.1) | BD Biosciences | Cat# 563789; RRID: AB_2738425 |
| Human CCR7/CD197-FITC (Clone 150503) | BD Biosciences | Cat# 561271; RRID: AB_10561679 |
| Human CD45RA- PE-Cy7 (Clone Hl100) | Biolegend | Cat# 304126; RRID: AB_10708879 |
| Human CD33-FITC (Clone 67.6) | Biolegend | Cat# 366620; RRID: AB_2566422 |
| Human CD70-PE-Cy7 (Clone 113–16) | Biolegend | Cat# 355112; RRID: AB_2687254 |
| Human CD27-BV786 (Clone L128) | BD Biosciences | Cat# 563327; RRID: AB_2744353 |
| Human CD71-FITC (CY1G4) | BioLegend | Cat# 334104; RRID: AB_2201482 |
| Human CD71-unconjugated (CY1G4) | BioLegend | Cat# 334102; RRID: AB_1134247 |
| Human CD69-APC (Clone FN50) | Biolegend | Cat# 310910; RRID: AB_314845 |
| Mouse TER-119-APC (Clone TER-119) | Biolegend | Cat# 116212; RRID: AB_313713 |
| Mouse NK-1.1-APC (Clone PK136) | Biolegend | Cat# 108710; RRID: AB_313397 |
| Mouse CD11b-APC (Clone M1/70) | Biolegend | Cat# 101212; RRID: AB_312795 |
| Mouse Ly-6G/Ly-6C-APC (Clone RB6–8C5) | Biolegend | Cat# 108412; RRID: AB_313377 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Donor Leukopaks | Massachusetts General Hospital Blood Bank | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| RosetteSep Human T cell Enrichment Kit | Stem Cell Technologies | Cat# 15061 |
| Cell Therapy Systems CD3/CD28 Dynabeads | ThermoFisher Scientific | Cat# 40203D |
| Recombinant Human IL-2 | Peprotech | Cat# 200–02 |
| 5-Azacytidine | Sigma-Aldrich | Cat# A1287 |
| Paraformaldehyde Solution, 4% in PBS | ThermoFisher Scientific | Cat# AAJ19943K2 |
| Cal-Ex Decalcifier | ThermoFisher Scientific | Cat# CS510–1D |
| Poly-L-lysine | Sigma-Aldrich | Cat# P4707 |
| Celltrace Far Red Proliferation Kit | Thermo Scientific | Cat# C34564 |
| Lipofectamine 3000 | Invitrogen | Cat# L3000075 |
| D-Luciferin | ThermoFisher Scientific | Cat# PI88294 |
| Critical commercial assays | ||
| CD27 ELISA | ThermoFisher Scientific | Cat# BMS286INST |
| Luciferase Assay System | Promega | Cat# E1501 |
| Deposited data | ||
| Cbioportal AML expression data | CPDM Pan-Cancer Derived Models | https://www.cbioportal.org/ |
| Experimental models: Cell lines | ||
| SupT1 (male) | ATCC | Cat# CRL-1942 |
| Molm13 (male) | Dr. David Weinstock (Dana Farber Cancer Institute) | N/A |
| Molm13 CD70- (male) | This manuscript | N/A |
| Molm13 CD70low (male) | This manuscript | N/A |
| Molm13 CD70low-int (male) | This manuscript | N/A |
| Molm13 CD70int (male) | This manuscript | N/A |
| Molm13 CD70high-int (male) | This manuscript | N/A |
| Molm13 CD70high (male) | This manuscript | N/A |
| Nomo1 (female) | Dr. Christopher Ott (Massachusetts General Hospital) | N/A |
| Monomac1 (male) | DSMZ | Cat# ACC 252 |
| THP-1 (male) | ATCC | Cat# TIB-202 |
| OCI-AML3 (male) | DSMZ | Cat# ACC 582 |
| HEK293 (female) | ATCC | Cat# CRL-3216 |
| Jurkat (male) | ATCC | Cat# TIB-152 |
| MM1.S (female) | ATCC | Cat# CRL-2974 |
| K562-CD70 (female) | This manuscript | N/A |
| K562 (female) | ATCC | Cat# CCL-243 |
| Experimental models: Organisms/strains | ||
| Mice: NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) | The Jackson Laboratory | Cat# JAX:005557; RRID:IMSR_JAX:005557 |
| DFAM68555 AML patient derived xenograft (female) | PRoXe database | https://www.proxe.org/ |
| Oligonucleotides | ||
| GAGCTGCAGCTGAATCACAC -CD70 CRISPR guide | Brunello library, Doench et al. 2016 | N/A |
| Recombinant DNA | ||
| trCD27–4-1BB- CD3ζ (native) | Designed per specifications from Wang et. al. 2017 | N/A |
| trCD27–4-1BB- CD3ζ (truncated stalk) | This manuscript | N/A |
| trCD27–4-1BB- CD3ζ (deleted stalk) | This manuscript | N/A |
| trCD27–4-1BB- CD3ζ (flexible linker stalk) | This manuscript | N/A |
| trCD27–4-1BB- CD3ζ (CD8H&TM) | This manuscript | N/A |
| trCD27 protein | This manuscript | N/A |
| Software and algorithms | ||
| Flowjo | FlowJo, LLC | https://www.flowjo.com/ |
| GraphPad Prism 9.3.1 | GraphPad Software Inc. | https://www.graphpad.com/ |
| Aura | Spectral Instruments Imaging | https://spectralinvivo.com/software/ |
| Geneious (11.1.5) | Geneious | https://www.geneious.com/ |
| Phyre2 | Kelley, et al. 2015 | http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index |
| Pymol (2.4.1) with Pymod (3.0.2) and ClustalW tool | Schrödinger | https://pymol.org/2/; https://github.com/pymodproject/pymod |
| SPICE 6 | Roederer et al. 2011 | https://niaid.github.io/spice/ |
| Fiji (Continuously updated, downloaded 2021) with white balance correction_1.0 plugin | Schindelin et al. 2012 | https://imagej.net/software/fiji/; https://github.com/pmascalchi/ImageJ_Auto-white-balance-correction |
| CleavPredict | Cieplak et. al. 2017 | http://cleavpredict.sanfordburnham.org |
| Other | ||
| Quantum Simply Cellular beads | Bangs Laboratories | Cat# 815 |
| HiScribe T7 Quick high yield RNA synthesis Kit | New England Biolabs | Cat# E2050S |
| Trucount tubes | BD Biosciences | Cat# 340334 |
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This paper | N/A |
| Bacterial and virus strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al., 2011 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al., 2016) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC | ATCC 700294 |
| Biological samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children’s Oncology Group Cell Culture and Xenograft Repository | http://cogcell.org/ |
| Chemicals, peptides, and recombinant proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350–13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433–59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 124–87-8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14–486 |
| GST-BMAL1 | Novus | Cat#H00000406-P01 |
| Critical commercial assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | PerkinElmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202–1012 |
| Deposited data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference | This paper; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This paper; Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental models: Cell lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09–0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental models: Organisms/strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and Nuesslein-Volhard, 2000 | ZFIN: ZDB-GENO-060207–1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al., 2012 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This paper | N/A |
| Primers for XX, see Table SX | This paper | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This paper | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT | Gene Tools | ZFIN: ZDB-MRPHLNO-061106–5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA | This paper | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This paper | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl0130415 |
| AAV2/1-hsyn-GCaMP6- WPRE | Chen et al., 2013 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al., 2009 | Addgene Plasmid #21339 |
| Software and algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This paper; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal | This paper | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This paper | https://github.com/chrisamiller/aml31SuppSite |
| Chemicals, peptides, and recombinant proteins | ||
| QD605 streptavidin conjugated quantum dot | Thermo Fisher Scientific | Cat#Q10101MP |
| Platinum black | Sigma-Aldrich | Cat#205915 |
| Sodium formate BioUltra, ≥99.0% (NT) | Sigma-Aldrich | Cat#71359 |
| Chloramphenicol | Sigma-Aldrich | Cat#C0378 |
| Carbon dioxide (13C, 99%) (<2% 18O) | Cambridge Isotope Laboratories | CLM-185–5 |
| Poly(vinylidene fluoride-co-hexafluoropropylene) | Sigma-Aldrich | 427179 |
| PTFE Hydrophilic Membrane Filters, 0.22 μm, 90 mm | Scientificfilters.com/Tisch Scientific | SF13842 |
| Critical commercial assays | ||
| Folic Acid (FA) ELISA kit | Alpha Diagnostic International | Cat# 0365–0B9 |
| TMT10plex Isobaric Label Reagent Set | Thermo Fisher | A37725 |
| Surface Plasmon Resonance CM5 kit | GE Healthcare | Cat#29104988 |
| NanoBRET Target Engagement K-5 kit | Promega | Cat#N2500 |
| Deposited data | ||
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Structure of compound 5 | This paper; Cambridge Crystallographic Data Center | CCDC: 2016466 |
| Code for constraints-based modeling and analysis of autotrophic E. coli | This paper | https://gitlab.com/elad.noor/sloppy/tree/master/rubisco |
| Software and algorithms | ||
| Gaussian09 | Frish et al., 2013 | https://gaussian.com |
| Python version 2.7 | Python Software Foundation | https://www.python.org |
| ChemDraw Professional 18.0 | PerkinElmer | https://www.perkinelmer.com/category/chemdraw |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| Other | ||
| DASGIP MX4/4 Gas Mixing Module for 4 Vessels with a Mass Flow Controller | Eppendorf | Cat#76DGMX44 |
| Agilent 1200 series HPLC | Agilent Technologies | https://www.agilent.com/en/products/liquid-chromatography |
| PHI Quantera II XPS | ULVAC-PHI, Inc. | https://www.ulvac-phi.com/en/products/xps/phi-quantera-ii/ |