KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-6x His tag | Abcam | Cat# 18184; RRID: AB_444306 |
| anti-actin | Abcam | Cat# 3280; RRID: AB_303668 |
| anti-DiMethyl-R #1 | Guo et. al. 2014a | Not commercially available |
| anti-DiMethyl-R #2 | Guo et. al. 2014a | Not commercially available |
| anti-DUSP4 | Cell Signaling | Cat# 5149; RRID:AB_2750867 |
| anti-Erk | Cell Signaling | Cat# 9102, RRID:AB_330744 |
| anti-FLAG | Sigma-Aldrich | Cat# F3165; RRID:AB_259529 |
| anti-GAPDH | Thermo | Cat# MA5-15738; RRID:AB_10977387 |
| anti-CD41a | BD Biosciences | Cat# 555465; RRID:AB_395857 |
| anti-CD235a | Bio-Rad | Cat# MCA506; RRID:AB_323506 |
| anti-H4 | Cell Signaling | Cat# 13919; RRID: AB_2798345 |
| anti-HA Tag | Millipore | Cat# 05-904; RRID: AB_11213751 |
| anti-6x His tag | Abcam | Cat# 18184; RRID: AB_444306 |
| anti-actin | Abcam | Cat# 3280; RRID: AB_303668 |
| anti-DiMethyl-R #1 | Guo et. al. 2014a | Not commercially available |
| anti-DiMethyl-R #2 | Guo et. al. 2014a | Not commercially available |
| anti-DUSP4 | Cell Signaling | Cat# 5149; RRID:AB_2750867 |
| anti-Erk | Cell Signaling | Cat# 9102, RRID:AB_330744 |
| anti-FLAG | Sigma-Aldrich | Cat# F3165; RRID:AB_259529 |
| anti-GAPDH | Thermo | Cat# MA5-15738; RRID:AB_10977387 |
| anti-CD41a | BD Biosciences | Cat# 555465; RRID:AB_395857 |
| anti-CD235a | Bio-Rad | Cat# MCA506; RRID:AB_323506 |
| anti-H4 | Cell Signaling | Cat# 13919; RRID: AB_2798345 |
| anti-HA Tag | Millipore | Cat# 05-904; RRID: AB_11213751 |
| anti-Mouse HRP | Santa Cruz | Cat# SC-2314; RRID: AB_641170 |
| anti-MKP2 | Santa Cruz | Cat# SC-1200; RRID: AB_2095314 |
| anti-p38 | Santa Cruz | Cat# SC-81621, RRID:AB_1127392 |
| anti-Phospho-Erk | Santa Cruz | Cat# SC-7976, RRID:AB_2297323 |
| anti-Phospho-p38 | Santa Cruz | Cat# SC-17852-R, RRID:AB_2139810 |
| anti-PRMT1 | Millipore | Cat # 07-404; RRID: AB_310588 |
| anti-Rabbit HRP | Santa Cruz | Cat# SC-2004; RRID: AB_631746 |
| anti-Erk | Cell Signaling | Cat# 9102, RRID:AB_330744 |
| anti-FLAG | Sigma-Aldrich | Cat# F3165; RRID:AB_259529 |
| anti-GAPDH | Thermo | Cat# MA5-15738; RRID:AB_10977387 |
| anti-CD41a | BD Biosciences | Cat# 555465; RRID:AB_395857 |
| anti-CD235a | Bio-Rad | Cat# MCA506; RRID:AB_323506 |
| anti-H4 | Cell Signaling | Cat# 13919; RRID: AB_2798345 |
| anti-HA Tag | Millipore | Cat# 05-904; RRID: AB_11213751 |
| anti-Mouse HRP | Santa Cruz | Cat# SC-2314; RRID: AB_641170 |
| anti-MKP2 | Santa Cruz | Cat# SC-1200; RRID: AB_2095314 |
| anti-p38 | Santa Cruz | Cat# SC-81621, RRID:AB_1127392 |
| anti-Phospho-Erk | Santa Cruz | Cat# SC-7976, RRID:AB_2297323 |
| anti-Phospho-p38 | Santa Cruz | Cat# SC-17852-R, RRID:AB_2139810 |
| anti-PRMT1 | Millipore | Cat # 07-404; RRID: AB_310588 |
| anti-Rabbit HRP | Santa Cruz | Cat# SC-2004; RRID: AB_631746 |
| anti-Tubulin | Proteintech | Cat# 66031-1; RRID: AB_11042766 |
| anti-Ubiquitin | Sigma-Aldrich | Cat# 07-2130; RRID:AB_11205591 |
| APC Mouse anti-human CD42b | eBioscience | Cat# 17-0429-42, RRID: AB_2573146 |
| APC Mouse anti-human CD42b | BD Biosciences | Cat# 551061; RRID:AB_398486 |
| APC Mouse anti-human CD71 | BD Biosciences | Cat# 551374; RRID:AB_3985004 |
| FITC Rat anti-Mouse CD41 | BD Biosciences | Cat# 553848 RRID:AB_395085 |
| ImmPRESS Anti-Rabbit Ig Reagent antibody | Vector Laboratories | Cat# MP-7401; RRID:AB_2336529 |
| PE Mouse anti-human CD41a | BD Biosciences | Cat# 557297; RRID:AB_396624 |
| PE Mouse anti-human CD41a | BD Biosciences | Cat# 555467; RRID:AB_395859 |
| PE Phospho-p38 MAPK | Invitrogen | Cat# 12-9078-42; RRID:AB_2572691 |
| PE Phospho-pS6 Ribosome Protein | Cell Signaling | Cat# 5316S; RRID:AB_10694989 |
| PE Rat anti-Mouse CD41 | BD Biosciences | Cat# 561850 RRID:AB_10896980 |
| PerCP/Cy5.5 anti-human CD41 | Biolegend | Cat# 303720; RRID: AB_2561732 |
| Bacterial and virus strains | ||
| One Shot BL21(DE3) | Invitrogen | Cat# C6000033 |
| Biological samples | ||
| Human bone marrow CD34+ progenitor cells | Lonza | 2M-101B |
| Human cord blood CD34+ progenitor cells | Lonza | 2C-101A |
| Human bone marrow CD34+ progenitor cells | Lonza | 2M-101B |
| Human cord blood CD34+ progenitor cells | Lonza | 2C-101A |
| Chemicals, peptides, and recombinant proteins | ||
| [3H-Me]-SAM | PerkinElmer Life Sciences | Cat# NET155V |
| 4-12% Bis-Tris gel | Bio-Rad | Cat#3450124 |
| Ammonium bicarbonate | Sigma-Aldrich | Cat# 9830 |
| anti-FLAG M2 agarose | Sigma-Aldrich | Cat# A2220 |
| BIT | Stem Cell Technology | Cat3 09500 |
| BTTP ligand | Chemical Synthesis Core, Albert Einstein College of Medicine |
N/A |
| complete Protease Inhibitor Cocktail | Roche | Cat# 11697498001 |
| Copper(II) sulfate pentahydrate | Sigma-Aldrich | Cat# 203165 |
| Cycloheximide | Cayman | Cat# 14126 |
| Dialyzed Fetal Bovine Serum | GIBCO | Cat# 26400-044 |
| Diazo Biotin-Azide | Click Chemistry Tools | Cat# 1041-25 |
| DMEM without glutamine, methionine, and cystine | GIBCO | Cat# 21013024 |
| DMSO | Sigma-Aldrich | Cat# D8418 |
| Dnase I | Roche | Cat# 10104159001 |
| DPBS | Corning | Cat# 21-030-CV |
| Dulbecco’s Modified Eagles Medium (DMEM) |
GE Healthcare | Cat# SH30243.01 |
| Fetal Bovine Serum | GE Healthcare | Cat# SH30910.03 |
| Glutathione Sepharose 4 Fast Flow GST-tagged protein purification resin | GE Healthcare | Cat# 17513202 |
| Human EPO | Amgen | N/A |
| Human EPO | Peprotech | Cat# 100-64 |
| Human FLT3L | Peprotech | Cat# 300-19 |
| Human IL3 | ConnStem | Cat# I 1003-A |
| Human IL6 | ConnStem | Cat# I 1006 |
| Human IL6 | Peprotech | Cat# 200-06 |
| Human Stem Cell Factor | ConnStem | Cat# S 1000 |
| Human Stem Cell Factor | Peprotech | Cat# 300-07 |
| Human TPO | ConnStem | Cat# T 1002 |
| Human TPO | Peprotech | Cat# 300-18 |
| Iscove’s Modified Dulbecco’s Medium (IMDM) |
GE Healthcare | Cat# SH30228.01 |
| Lipofectamine 3000 | Invitrogen | Cat# L3000008 |
| Luminata Western Chemiluminescent reagent | Millipore | Cat# WBLUC0500 |
| Lysozyme | MP Biochemicals | Cat# 100834 |
| MG132 | Cayman | Cat# 10012628 |
| Ni2+-NTA beads | QIAGEN | Cat# 1018244 |
| Nitrocellulose Membrane | Bio-Rad | Cat# 1620167 |
| Pierce High Capacity Streptavidin Agarose beads | Thermo | Cat# 20359 |
| PMA | Cayman | Cat# 10008014 |
| PVDF Membrane | Millipore | Cat# PFL00010 |
| RPMI 1640 | Corning | Cat# 10-040-CV |
| RPMI 1640 without methionine | GIBCO | Cat# A1451701 |
| SAM (S-Adenosyl-Methionine) | Sigma-Aldrich | Cat# A7007 |
| Sodium hydrosulfite | Sigma-Aldrich | Cat# 157953 |
| Triethanolamine | Sigma-Aldrich | Cat# 90279 |
| Trypsin | Promega | Cat# V5280 |
| Critical commercial assays | ||
| CellTiter-Glo Viability Assay Kit | Promega | Cat# G7572 |
| Direct-Zol RNAprep Kit | ZYMO | Cat# R2062 |
| ImmPACT Vector Red Substrate Kit | Vector Laboratories | Cat# SK-5105; RRID:AB_2336524 |
| ImmPRESS HRP Anti-Mouse IgG Polymer Detection Kit |
Vector Laboratories | Cat# MP-7452; RRID:AB_2744550 |
| MegaCult-C Medium with Lipids | STEMCELL | Cat# 04850 |
| MegaCult-C Complete Kit with Cytokines; Collagen |
STEMCELL | Cat# 04901, 04902 |
| Methylcellulose Base Media kit | R&D | Cat# HSC002 |
| Verso cDNA synthesis Kit | Thermo | Cat# AB1453 |
| Deposited data | ||
| sc-RNA sequencing analysis | NCBI | GSE174261 |
| Experimental models: Cell lines | ||
| CMK | DSMZ | Cat# ACC-392; RRID: CVCL_0216 |
| HEK293T | ATCC | Cat# CRL-3216; RRID: CVCL_0063 |
| K562 | ATCC | Cat# CCL-243; RRID: CVCL_0004 |
| MEG-01 | ATCC | Cat# CRL-2021; RRID: CVCL_0005 |
| NB4 | Dr. Stephen Nimer | RRID: CVCL_0005 |
| Experimental models: Organisms/strains | ||
| C57BL/6j mouse | Jackson Laboratory | |
| Oligonucleotides | ||
| PRMT1-Fwd real-time PCR: 5′ CCA GTG GAG AAG GTG GAC AT |
This Study | N/A |
| PRMT1-Rev real-time PCR: 5′ CTC CCA GTG GAT CTT GT |
This Study | N/A |
| DUSP4-Fwd real-time PCR: 5′ AGG CGG CTA TGA GAG GTT TT |
This Study | N/A |
| DUSP4-Rev real-time PCR: 5′ CAC TGC CGA GGT AGA GGA AG |
This Study | N/A |
| HPRT1-Fwd real-time PCR: 5′ CAC CCT TTC CAA ATC CTC AG |
This Study | N/A |
| HPRT1-Rev real-time PCR: 5′ CTC CGT TAT GGC GAC CCG CA |
This Study | N/A |
| Recombinant DNA | ||
| Plasmid: pcDNA3.1 | Thermo Fisher | Cat# V79020; Addgene: #2093 |
| Plasmid: pGEX-6p-1 | GE HealthCare | Cat# 28-9546-48; Addgene: #2887 |
| Plasmid: pLKO.1 | David Root | Addgene: #10878 |
| Plasmid: pLEX_307 | David Root | Addgene: #41392 |
| Plasmid: pBGJR-GFP | Dr. Vladimir Jankovic | Not commercially available |
| Plasmid: pLV-EF1a-IRES-Neo | Hayer et al., 2016 | Addgene: #85139 |
| Plasmid: pTripZ | Thermo Fisher | Addgene: #5561 |
| pLKO.1-shDUSP4#1 | Sigma-Aldrich | target sequence: GCCTACCTGATGATGAAGAAA |
| pLKO.1-shDUSP4#2 | Sigma-Aldrich | target sequence: CCCAGTGGAAGATAACCACAA |
| pLKO.1-shHUWE1 | Sigma-Aldrich | target sequence: AAACCCAGGGCTGCCTTGGAAAAG |
| Software and algorithms | ||
| STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| SPRING | Weinreb et al., 2018 | https://kleintools.hms.harvard.edu/tools/spring.html |
| MAGIC | van Dijk et al., 2018 | https://www.krishnaswamylab.org/projects/magic |
| Other | ||
| BD Accuri C6 | BD Biosciences | N/A |
| BD FACSAria II | BD Biosciences | N/A |
| BD LSRFortessa Special Order System | BD Biosciences | N/A |
| Bio-Rad ChemiDoc MP system | Bio-Rad | Cat# 170-8280 |
| Bioruptor Ultra-sonication system | Diagenode | Cat# UCD-300 |
| PDMS Microfluidic Devices | FlowJEM | N/A |
| Synergy H1 plate reader | BioTek | Cat# 8041000 |
| TRI-CARB 4910TR 110 V Liquid Scintillation Counter |
PerkinElmer Life Sciences | Cat# A491000 |